Labshake search
Citations for Thermo Fisher :
1901 - 1950 of 10000+ citations for 2 4 Methyl 5 thiazolyl ethyl decanoate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... the insoluble pellet fractions (2 A260 units) were separated on NuPAGE 4-12% Bis-Tris 15-well gels (Invitrogen), run in NuPAGE 1x MOPS SDS running buffer (Novex) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Chromosomes were counterstained for 20 minutes with 1 μg/ml DAPI (4’,6-diamidino-2-phenylindole; ThermoFisher Scientific, D3571) in 2x SSC ...
-
bioRxiv - Systems Biology 2021Quote: ... Fat and lower dermis was cut away and discarded before dispase (2 U/ml, Gibco, UK, 20h, +4°C) digestion ...
-
bioRxiv - Genetics 2021Quote: ... overnight at 4°C and then for 2 hours with Dynabeads M-280 Sheep Anti-Mouse IgG (Invitrogen 11201D). After 3 800uL washes in LiCl buffer (100mM Tris HCl pH 7.5 ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were then washed twice with PBS and stained with 4′,6-diamidino-2-phenylindole (DAPI, Thermo Scientific #D1306) diluted 1:200 in 0.5% BSA in PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... loaded with 2-4 μM Fluo-5N and incubated with 200 nM MitoTracker® Red CMXRos – M7512 (Invitrogen, USA). To load Fluo-5N ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mesenteries were then stored for up to 48hrs at 4°C into PBS with 2% Antibiotic-Antimycotic solution (ThermoFisher).
-
bioRxiv - Bioengineering 2022Quote: ... glacial acetic acid) for 2 hours at room temperature (Section 2.14) or methanol-free 4% formaldehyde (ThermoFisher, Section 2.16) and then kept in PBS at 4°C before washing in gradations of ethanol up to 100% ...
-
bioRxiv - Systems Biology 2022Quote: ... Cells were mounted with the ProLong™ Diamond Antifade Mountant with 4’,6-Diamidino-2-Phenylindole (DAPI) (ThermoFisher Scientific). Ki-67 signals were visualized with Nikon microscopy ...
-
bioRxiv - Neuroscience 2020Quote: ... Coverslips were affixed using Prolong Gold Antifade Mountant with 4’,6-diamidino-2-phenylindole (DAPI) (ThermoFisher Scientific, Cat. # P36935).
-
bioRxiv - Microbiology 2021Quote: ... Previously pelleted spheroplasts were resuspended in 1 mL 10mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffer solution (Gibco) and 100 μl were collected as whole spheroplasts ...
-
bioRxiv - Microbiology 2020Quote: ... were quantified using an avidin and 4’-hydroxyazobenzene-2-carbocylic acid assay according to the manufacturer’s instructions (Fisher Scientific). Briefly ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were marked with 2,3×10−3 μg/μL 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Thermo Fisher Scientific) for 10 minutes at room temperature in the dark ...
-
bioRxiv - Bioengineering 2021Quote: ... Cells were washed again in PBS and incubated overnight with 4’,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) and Alexa Fluor 647-conjugated βIII tubulin (Abcam ab190575) ...
-
bioRxiv - Microbiology 2021Quote: ... Nuclear staining was performed by incubating slides with 4’,6-diamidino-2-phenylindole (DAPI, final 0.5 μg/mL; Invitrogen). Images were captured using an epifluorescence microscope (Nikon Eclipse Ni ...
-
bioRxiv - Cell Biology 2020Quote: ... Ni-NTA His.Bind® Resin (2-4 ml) was packed into a 10 ml Pierce disposable column (Thermo Fisher) and connected to the peristaltic pump ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Homogenised leaf tissues were centrifuged at 18,000 g 10 min 4 °C and 2 μL supernatant mixed with 48 μL Bradford reagent (ThermoFisher Scientific ...
-
bioRxiv - Biophysics 2020Quote: ... Grids were blotted for 4 seconds at -2 force and vitrified in liquid ethane using a MarkIV Vitrobot (ThermoFisher). The blotting chamber was maintained at 22°C and 100% humidity during freezing.
-
bioRxiv - Cell Biology 2020Quote: ... The slides were washed and mounted with ProLong Gold antifade reagent with DAPI (4’,6-diamidino-2-phenylindole) (Invitrogen) and images were acquired using Nikon A1-R confocal microscope using the NIS Elements software ...
-
bioRxiv - Cell Biology 2020Quote: ... The immunoprecipitates were dissolved in 2×SDS loading buffer and resolved on NuPAGE 4–12% Bis-Tris gel (Invitrogen), and then silver stained using Pierce silver stain kit (Thermo) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Tissues were immersed in 2ml dissociation solution (2% FCS-PBS solution with approximate 145U/ml type 4 Gibco collagenase) and incubated at 37°C for 30 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... sections were incubated with 0.2 μM of 4’,6-diamidino-2-phenylindole (DAPI) (Molecular Probes, Life Technologies, Carlsbad, CA) in PBS pH 7.4 ...
-
bioRxiv - Cell Biology 2020Quote: ... sections were incubated with 0.2 μM of 4’,6-diamidino-2-phenylindole (DAPI) (Molecular Probes, Life Technologies, Carlsbad, CA) in PBS pH 7.4 ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μL of capture Ab (~4 μg/ml) or SARS-CoV-2 recombinant antigen (~0.2 mg/ml) in 1x PBS (Gibco) was loaded in each channel ...
-
bioRxiv - Cancer Biology 2022Quote: ... thinly sliced (1-2 mm) tissue samples were fixed overnight at 4°C in neutral-buffered formalin (Fisher Scientific) with PhosSTOP added (Roche) ...
-
bioRxiv - Bioengineering 2022Quote: ... 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl) (16:0 NBD) were purchased from Invitrogen. Phosphate-buffered saline (PBS ...
-
bioRxiv - Developmental Biology 2022Quote: ... for 2 hours at 250mA and 4°C using cold transfer buffer (1.5x NuPAGE transfer buffer (Thermo Fisher Scientific), 10% methanol ...
-
bioRxiv - Cell Biology 2022Quote: ... or 2-well and 4-well chamber slides were transiently transfected with various cDNA constructs using Lipofectamine 2000 (Invitrogen) or FuGENE 6 (Promega ...
-
bioRxiv - Genetics 2022Quote: ... Coverslips were mounted with Prolong gold antifade reagent with 4′,6-diamidino-2-phenylindole (DAPI, P36931, Thermo Fisher Scientific) and analyzed under a Zeiss LSM 510 Meta Confocal microscope (Carl Zeiss ...
-
bioRxiv - Microbiology 2022Quote: ... PCDH1 variants (sEC1-2 and sEC1-4) were generated by cloning the following sequences into the pcDNA3.1 mammalian expression vector (ThermoFisher): EC1-EC2 (residues 1-284 ...
-
bioRxiv - Neuroscience 2023Quote: ... and concentrated by centrifugation at 85,000x g for 2 hours at 4°C in a Sorvall WX 100 Ultra Ultracentrifuge (ThermoFisher). The supernatant was discarded and viral pellet resuspended in a volume of PBS containing calcium and magnesium (#14090-055 ...
-
bioRxiv - Neuroscience 2022Quote: ... 4’,6-diamidine-2-phenylindole dihydrochloride And coverslipped using ProLong™ Gold Antifade Mountant (Invitrogen by Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2022Quote: ... 4’,6-diamidine-2-phenylindole dihydrochloride And coverslipped using ProLong™ Gold Antifade Mountant (Invitrogen by Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2023Quote: ... p21) and pAAV target plasmid in a 4:1:1:2 molar ratio by use of Lipofectamine 2000 (ThermoFisher) according to company protocol ...
-
The logic of native enhancer-promoter compatibility and cell-type-specific gene expression variationbioRxiv - Genomics 2022Quote: ... All cell lines were passaged regularly (every 2 to 4 days) with Accutase (PAA) or TrypLE (Thermo Fisher Scientific), and ESCs and EpiSCs were occasionally selected for Oct4 expression with 1µg/ml puromycin (Sigma) ...
-
bioRxiv - Plant Biology 2024Quote: DAPI (4′,6-diamidino-2-phenylindole) solution: Dilute 1 mg/ml DAPI (ThermoFisher, Cat. No. 62248, Rockford, IL, USA) to a final concentration of 0.5 µg/ml in 1x PBST (0.1% Tween-20).
-
bioRxiv - Microbiology 2024Quote: ... and 2 µL RNase A/T1 Mix (4 µg RNase A, 10 U RNase T1, ThermoFisher Scientific, MA, USA) at 37°C for 30 min to remove host-originating nucleic acids ...
-
bioRxiv - Physiology 2023Quote: ... the sections were incubated with 4’,6-diamidino-2-phenylindole (DAPI; D1306, Thermo Fisher Scientific; 1:1000 in PBS) for 2min at room temperature to counterstain the nucleus before being washed twice in PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:2000 LipidTOX was added along with 0.25 μg/ml of 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes) for 15 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Slides were washed in PBS and nuclei were stained with 4’-6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) and mounted with an aqueous mounting medium (Aqua-Poly/Mount ...
-
bioRxiv - Molecular Biology 2023Quote: ... and MUTYH KO cells were obtained by infection of BJ FAP-TRF1 WT with lentivirus expressing respectively guide RNAs targeting OGG1 exon 4 (gRNA3, sequence GCTACGAGAGTCCTCATATG) and MUTYH exon 2 (gRNA5, sequence GCATGCTAAGAACAACAGTC) and selected with 1.5 µg/ml Puromycin (Gibco). OGG1 KO/MUTYH KO (DKO ...
-
bioRxiv - Microbiology 2023Quote: ... The obtained cDNA was diluted to 2-4 ng/µl for subsequent qPCR with the Sybr Green (Applied Biosystems) method ...
-
bioRxiv - Neuroscience 2023Quote: ... Cell nuclei were stained with 4’,6-Diamidine-2’-phenylindole dihydrochloride (DAPI, 1:1000, Invitrogen, Thermo Fisher Scientific, MA) for 10 mins ...
-
bioRxiv - Neuroscience 2023Quote: ... Cell nuclei were stained with 4’,6-Diamidine-2’-phenylindole dihydrochloride (DAPI, 1:1000, Invitrogen, Thermo Fisher Scientific, MA) for 10 mins ...
-
bioRxiv - Cancer Biology 2023Quote: ... reagent at a 4:2:3 ratio of sgRNA/overexpression-construct: pVSVG: psPAX2 in Opti-MEM media (Life Technologies, Thermo Fisher Scientific Inc ...
-
bioRxiv - Bioengineering 2023Quote: ... the retinal sections were mounted with Fluoromount G™ containing 2-(4-Amidinophenyl)-1H-indole-6-carboxamidine (DAPI, Invitrogen) for nuclei detection ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cell pellets were finally resuspended in wash buffer containing 1 µg/ml 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) or 7-AAD viability dye (BioLegend ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were stored in 2% PFA at 4°C prior to analysis using an Attune NxT Flow Cytometer (Invitrogen) in the Flow Cytometry Core Facility of the Faculty of Medicine & Dentistry at the University of Alberta ...
-
bioRxiv - Developmental Biology 2023Quote: ... resuspended in mounting media containing 4’,6’-diamidino-2-phenylindole (DAPI) (Fluoromount-G™ Mounting Medium, with DAPI, Invitrogen), incubated overnight at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... (BEI NR-52310) or pSARS2-SΔCT and 4 μg pTRMPSS2 (VRC/NIAID) diluted in 2 mL OPTIMEM media (Gibco) (DNA OPTIMEM mixture) ...