Labshake search
Citations for Thermo Fisher :
1751 - 1800 of 10000+ citations for rno mir 143 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... using the BLOCK-iT Pol II miR RNAi expression vector kit (Invitrogen). The vector construct contained an engineered miR sequence to drive Gpr88 knock-down ...
-
bioRxiv - Cancer Biology 2020Quote: ... the cells were transfected with Anti-hsa-mir-7704 inhibitor AM29132 (ThermoFisher) according to manufacturer’s instructions at 100 nM for 48 hr ...
-
bioRxiv - Cell Biology 2020Quote: ... hsa-miR-494-3p inhibitor (MIMAT002816) (Cat 4464084, Assay ID MH12409, Ambion). Negative Control LNA mimic (Cat ...
-
bioRxiv - Cell Biology 2020Quote: ... hsa-miR-494-3p mimic (MIMAT002816) (Cat 4404066, Assay ID MC12409, Ambion), mirVana miR inhibitor negative control #1 (Cat 4464076 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Pre-miR™ Negative Control #2 (Thermo Fisher Scientific, Waltham, MA, USA) was used to represent the negative control ...
-
bioRxiv - Physiology 2022Quote: ... Mature miR-29b expression was assayed using TaqMan MicroRNA Assays (Applied Biosystems). Briefly ...
-
bioRxiv - Microbiology 2023Quote: ... mirVana® miRNA mimics and anti-miR™ miRNA inhibitors (Thermo Fisher) were transfected according to the manufacturer’s protocols using Lipofectamine RNAi MAX (Thermo Fisher ...
-
bioRxiv - Genomics 2023Quote: ... TaqMan™ MicroRNA Assay hsa-miR-124-3p (ThermoFisher, AssayID 003188_mat, 4440886), TaqMan™ MicroRNA Control Assay U6 snRNA (ThermoFisher ...
-
bioRxiv - Genomics 2023Quote: ... TaqMan™ MicroRNA Assay hsa-miR-423-5p (ThermoFisher, AssayID 002340, 4427975), and TaqMan™ Fast Advanced Master Mix (ThermoFisher ...
-
bioRxiv - Bioengineering 2023Quote: ... 0.5 pmol synthetic cel-miR-39-3p (Thermo Scientific, Waltham, MA, USA) was added to the samples during cell/MP lysis as a spike-in control ...
-
bioRxiv - Cancer Biology 2023Quote: ... or transfected with 50nM folate-miR-34a using Lipofectamine RNAiMAX (Life Technologies). At the indicated time points ...
-
bioRxiv - Neuroscience 2023Quote: ... in addition to the Mir plasmids described above (Invitrogen Block it kit) were pCAGGS-GFP (gift from S ...
-
bioRxiv - Plant Biology 2023Quote: ... Primers (Invitrogen) were designed using the “Primer3Plus” software with an annealing temperature of 55°C (Table S1).
-
bioRxiv - Biochemistry 2023Quote: ... Primers (Invitrogen) used for the pRSET-A vector were 5’-GGATCCACGCGGAACCAGACCATGATGATGATGATGATGAGAACCCCGCAT-3’ (forward) ...
-
bioRxiv - Neuroscience 2024Quote: ... Primers (ThermoFisher) (detailed in Supplementary Table 4 ...
-
bioRxiv - Immunology 2021Quote: Xela DS2 (passages 135 – 140) and Xela VS2 (passages 138 – 143) cells were seeded in a 48-well plate (Thermo Fisher Scientific) at a final cell density of 50,000 cells/well in 0.3 mL Xela complete media and allowed to adhere overnight at 26 °C ...
-
bioRxiv - Physiology 2020Quote: ... The expression of genes of interest was measured by a one-step quantitative RT-PCR with TaqMan Universal PCR Master Mix reagents (ThermoFisher Scientific, Waltham, MA) using an Applied Biosystems QuantStudio 3 real-time PCR system (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... The viral genome was evaluated by quantitative real-time PCR using the Superscript ® III Platinum ONE-STEP RT-PCR system kit with the Platinum™ Taq DNA polymerase system (Invitrogen, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... was transferred to 96-well Reaction Plates (0.1 mL) and RT-PCR amplification conducted with a 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA) under the following cycling conditions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Quantitative reverse transcription-PCR (RT-PCR) for cytokine mRNA expression levels was performed in triplicate using PowerUp™ SYBR™ Green Master Mix (Thermo Scientific). Primers used are listed in Table S1 ...
-
bioRxiv - Physiology 2019Quote: ... RT-PCR was carried out in triplicate with a QuantStudio 12K Flex Real-Time PCR System (4471134, Applied Biosystems, Foster City, CA, USA) using the SYBR Green PCR Master Mix (04707516001 ...
-
bioRxiv - Pathology 2019Quote: ... was used for the first-strand cDNA synthesis and quantitative RT-PCR was performed using the 7500 Fast Real-Time PCR System (Applied Biosystems, Carlsbad, CA). Each cDNA template was amplified in triplicates using SYBR Green PCR Master Mix.
-
bioRxiv - Evolutionary Biology 2021Quote: ... Reverse transcription PCR was performed with 9 µl of those samples free of DNA with the RT-PCR kit (Applied Biosystems, Karlsruhe, Germany) according to the manufacturer’s instruction ...
-
Epigenetic Interaction between UTX and DNMT1 Regulates Diet-Induced Myogenic Remodeling in Brown FatbioRxiv - Physiology 2020Quote: ... The mRNA of genes of interest was measured by an one-step quantitative RT-PCR with a TaqMan Universal PCR Master Mix kit (ThermoFisher Scientific, Waltham, MA) using an Applied Biosystems QuantStudio 3 real-time PCR system (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... The viral cDNA was amplified from extracted RNA through one-step reverse transcription-PCR amplification by using SuperScript III One-Step RT-PCR system with High Fidelity Platinum Taq DNA Polymerase (Invitrogen, Life Technologies, USA) with degenerate primers (10uM MBTuni-12M and MBTuni-13 ...
-
bioRxiv - Microbiology 2022Quote: ... Viral RNA from all samples was quantified using real-time RT-PCR analysis with EXPRESS One-step Superscript qRT-PCR kit (Invitrogen; Thermo Fischer Scientific) and QuantStudio 7 Flex Real-Time PCR system (Applied Biosystems ...
-
bioRxiv - Microbiology 2023Quote: ... and the viral genomic copies were quantified using a real-time reverse transcription PCR (RT-PCR) (VetMax-Gold SIV Detection Kit, Life Technologies, Austin, TX). A standard curve was established using a chemically synthesized RNA fragment with known copy numbers ...
-
bioRxiv - Neuroscience 2023Quote: ... Real-time reverse transcription polymerase chain reactions (RT-PCRs) were performed on the QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems, Life Technologies). Data were normalized to housekeeping genes (Tubulin ...
-
bioRxiv - Physiology 2023Quote: ... cDNA was prepared from 100 ng of total RNA by reverse transcription PCR (RT–PCR) using a High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher, Ref: 4368814) per the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... Total RNA reverse transcription and Real-time PCR (RT-PCR) was performed with High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Cat # 4368814) and Power Up SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Cell Biology 2020Quote: cDNA was generated using the Superscript III First-Strand Synthesis System for RT-PCR Kit (Invitrogen) per manufacturer’s instructions and all qRT-PCR was performed on a CFX Connect Real-Time System (Bio-Rad ...
-
bioRxiv - Developmental Biology 2021Quote: Quantitative real-time RT-PCR was performed using an ABI Prism 7500 Fast SDS (Applied Biosystems). Total RNA was extracted using NucleoSpin RNAII kit (Takara ...
-
bioRxiv - Molecular Biology 2021Quote: ... quantitative RT-PCR was performed using a SYBR Green Master Mix (Applied Biosystems, Foster City, CA) and primer pairs for sodium phosphate cotransporters ...
-
bioRxiv - Molecular Biology 2020Quote: qPCR reactions were carried out using a Step-One Plus RT-PCR thermal cycler (Applied Biosystems), Luna Universal qPCR Master Mix (New England Biolabs) ...
-
bioRxiv - Genomics 2020Quote: ... The amplification process was done using SuperScript ™ IV One-Step RT-PCR System kit (Invitrogen) as follows ...
-
bioRxiv - Developmental Biology 2020Quote: ... Total RNA was reverse transcribed using SuperScript™ First-Strand Synthesis System for RT- PCR (Invitrogen) with oligo-d(T ...
-
bioRxiv - Neuroscience 2019Quote: ... RT-qPCR reactions were run on an ABI 7500 Fast Real-Time PCR system (Applied Biosystems) with the following conditions ...
-
bioRxiv - Microbiology 2020Quote: ... and RT-qPCR was performed using SYBR® Green Real-Time PCR Master Mixes (Invitrogen™) and the StepOnePlus Real System (Applied Biosystems™) ...
-
bioRxiv - Immunology 2020Quote: ... and amplified with the SuperScript III Platinum one-step quantitative RT-PCR system (Thermo Fisher Scientific). Samples were then run on a LightCycler480 (Roche ...
-
bioRxiv - Immunology 2019Quote: ... and RT-PCR was performed using the SuperScript™ III First-Strand Synthesis System kit (Invitrogen). Quantitative RT-PCR was performed using the Fast SYBR™ Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2019Quote: ... RT-qPCR reactions were run on an ABI 7500 Fast Real-Time PCR system (Applied Biosystems) with the following conditions ...
-
bioRxiv - Genomics 2021Quote: ... RT-qPCR was performed using an ABI 7500 Real-Time PCR system (Applied Biosystems, CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse transcription was performed using the SuperScript™ III One-Step RT-PCR System (Invitrogen, 12574026) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... RT-qPCRs were run in a QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems). Relative quantification was determined using the ΔΔCt method and normalized to the endogenous controls RPLP0 and GAPDH (GAPDH FWD 5’-3’= GTTCGACAGTCAGCCGCATC ...
-
bioRxiv - Cell Biology 2021Quote: ... and RT-qPCR was performed using Power SYBR™ Green PCR Master Mix (ThermoFisher Scientific, 4367659), on CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Plant Biology 2021Quote: ... The relative expression values were analyzed using the SYBR Prime Script RT-PCR kit (Thermo Scientific) in ABI PRISM 7500 Fast (Applied Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... RT-PCR reactions were applied to the PowerUp SYBG Green Master Mix Kit from Applied Biosystems, USA ...
-
bioRxiv - Microbiology 2019Quote: ... and cDNA was synthesized by RT-PCR using a SuperScript® VILOTM cDNA Synthesis Kit (Invitrogen). The coding regions of the H and L chains of M2 and M4 were amplified by PCR using KOD-Plus-Neo (TOYOBO ...
-
bioRxiv - Cancer Biology 2020Quote: ... followed by RT-qPCR analysis with SYBR green PCR master mix (Thermo Fisher; Cat. No. 4309155) on a QuantStudio™ 7 Flex Real-Time PCR System ...
-
bioRxiv - Neuroscience 2020Quote: ... RT-PCR was performed by High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA) using random primers and following standardized protocols.