Labshake search
Citations for Thermo Fisher :
1551 - 1600 of 10000+ citations for 6H Dibenzo b d pyran 3 pentanaminium 6a 7 10 10a tetrahydro 1 hydroxy N N N 6 6 9 hexamethyl 6aR trans 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... and pcDNA-DEST53 (for N-terminal GFP fusion in mammalian cells, cat#12288015, Thermo Fisher Scientific, Waltham, MA, USA). Modified forms of Ctb (Ctb-ARVA (771-FRVP-774 to 771-ARVA-774) ...
-
bioRxiv - Microbiology 2023Quote: ... Total organic carbon (TOC) and TN were determined using a C/N analyzer (Flash EA 1112, Thermo Fisher Scientific). Soil texture was determined using the hydrometer method based on Stokes’ law (analyzed by Dr ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cloned sequence was verified by sequencing and it was transferred to the pcDNA5-FRT-TO-N-GFP Gateway destination vector by LR recombination according to the manufacturer’s protocol (Invitrogen). HeLa Flp-In/T-REx cells ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNA was collected from EO771.LMB tumors that were xenografted into B6 and PWD.B6 mice (n = 4 per group) isolated using TRIzol Reagent (ThermoFisher), poly-A purified ...
-
Engineered autocrine signaling eliminates muscle cell FGF2 requirements for cultured meat productionbioRxiv - Bioengineering 2023Quote: ... and seeded onto new 6-well plates at 2,500 cells/cm2 with 1.5 μg/cm2 of truncated recombinant human vitronectin (Vtn-N; ThermoFisher #A14700). After allowing cells to adhere overnight ...
-
bioRxiv - Biochemistry 2023Quote: ... 10x serial dilutions were made in 0.1% formic acid 0.1% n-Dodecyl-beta-Maltoside Detergent (DDM, Thermo Fisher, 89902) in LCMS grade water ...
-
bioRxiv - Cell Biology 2023Quote: ... and the single strand cDNA was cleaned up with DynaBeads® MyOneTM Silane Beads (Life Technologies P/N 37002D). cDNA was amplified using a Bio-Rad PTC-200 Thermal cycler with 0.2 ml 8-strip nonFlex PCR tubes ...
-
bioRxiv - Neuroscience 2023Quote: Whole mouse brains were homogenized with a Dounce tissue grinder in neuronal protein extraction reagent (N-PER) (Thermo Scientific) containing protease/phosphatase inhibitors (Cell Signaling ...
-
bioRxiv - Bioengineering 2024Quote: ... Amount of N-Glycan was measured by integrating the peaks with Thermo Xcalibur software (Thermo Fisher Scientific, Waltham, MA) giving the normalized ...
-
bioRxiv - Developmental Biology 2024Quote: ... Matrix coating was then performed by incubating the wells at room temperature for 30 min on a rocker with a mixture of 40µg/mL rhVitronectin-N (A14700, ThermoFisher) and 10µg/mL rhLaminin521 (A29249 ...
-
bioRxiv - Biophysics 2024Quote: ... and α-synuclein) were mixed with an excess of N-hydroxysuccinimide (NHS)-ester-functionalized Alexa 488 dye (Thermo Fisher). The dye-to-protein ratios were optimized to maintain an average degree of labeling (DOL ...
-
bioRxiv - Cancer Biology 2020Quote: ... Proton transport was measured using ATP-dependent quenching of 9-amino-6-chloro-2-methoxy-acridine (Acridine Orange, ThermoFisher) fluorescence quenching for isolated vacuoles as previously described21
-
bioRxiv - Microbiology 2023Quote: ... live/dead staining was carried out using 6 μM syto 9 and 30 μM propidium iodide (BacLight, Molecular Probes). Biofilms were imaged using a Zeiss LSM 700 compact confocal laser scanning microscope using the 40x objective and appropriate fluorescence settings (syto 9=488 nm laser ...
-
bioRxiv - Molecular Biology 2024Quote: WT and TRBP−/− HeLa cells were plated at 4 x 106 cells / dish into a 9-cm dish and transfected with 6 µg/dish poly(I:C) using Lipofectamine 2000 (Invitrogen). At 0 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The samples were subjected to 6 rounds of 10 sec sonication each at power 3 in a 550 Sonic Dismembrator (Fisher Scientific). Between each round of sonication ...
-
bioRxiv - Biophysics 2020Quote: ... MCF 10A cells (ATCC) were cultured in Dulbecco’s modified Eagle medium (D-MEM) 1g/l glucose (Invitrogen), supplemented with 10% horse serum (Invitrogen) ...
-
bioRxiv - Bioengineering 2023Quote: ... in PBS pH 7.4 or pH 6), HA (Sigma-Aldrich, 9067-32-7, 0.5%–1% w/v in Hanks’ Balanced Salt Solution (Gibco, 14025-050) or Dulbecco’s modified Eagle’s medium (DMEM ...
-
REGN-COV2 antibody cocktail prevents and treats SARS-CoV-2 infection in rhesus macaques and hamstersbioRxiv - Microbiology 2020Quote: ... Reactions were carried out on a QuantStudio 6 and 7 Flex Real-Time PCR System (Applied Biosystems) according to the manufacturer’s specifications ...
-
bioRxiv - Immunology 2020Quote: ... Reactions were carried out on a QuantStudio 6 and 7 Flex Real-Time PCR System (Applied Biosystems) according to the manufacturer’s specifications ...
-
bioRxiv - Immunology 2020Quote: ... and ran in duplicate using the QuantStudio 6 and 7 Flex Real-Time PCR System (Applied Biosystems) according to manufacturer’s specifications ...
-
bioRxiv - Immunology 2021Quote: ... Reactions were carried out on a QuantStudio 6 and 7 Flex Real-Time PCR System (Applied Biosystems) according to the manufacturer’s specifications ...
-
bioRxiv - Immunology 2021Quote: ... Reactions were carried out on a QuantStudio 6 and 7 Flex Real-Time PCR System (Applied Biosystems) according to the manufacturer’s specifications ...
-
bioRxiv - Cell Biology 2024Quote: Vacuolar pH alterations were detected using the 5-(and-6)-carboxy-2′,7′-dichlorofluorescein diacetate (CDCFDA, Invitrogen) probe ...
-
bioRxiv - Synthetic Biology 2023Quote: Protein thermal stability was measured by differential scanning fluorimetry using a QuantStudio Pro 6/7 (Applied Biosystems). Protein was brought to a concentration of 10 uM with 5x Sypro Orange dye in a final volume of 20 µL in 20 mM NaPi ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Bioengineering 2024Quote: ... 80-90 % of cell cultures were split into a ratio of 1/3 to 1/6 using Tryple Express Enzyme (Gibco, 12604021) and Dulbecco’s phosphate-buffered saline (DPBS ...
-
bioRxiv - Genetics 2021Quote: ... 6-VIC ® or 6-PET® (Life Technologies Corporation, Carlsbad, USA). During capillary electrophoresis ...
-
bioRxiv - Biochemistry 2021Quote: ... 6% native PAGE gels were prepared by first making a gel solution containing 6% acrylamide (29:1) (Fisher Scientific).15 This solution was then degassed under vacuum and mixing ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell proliferation was assessed at different time points (3, 5, 7 and 9 days) using AlamarBlue Cell Viability Reagent (Invitrogen) per manufacturer’s instructions ...
-
bioRxiv - Physiology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI, 1:25000, Thermo Fisher) diluted in PBS and mounted with Prolong Gold Antifade Medium (Invitrogen) ...
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6-Diamadino-2-phenylindole (DAPI, 1:1000, Invitrogen) was incubated after secondary antibody incubation for 15 min at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:1000), Mouse antiglial fibrillary acidic protein (GFAP ...
-
bioRxiv - Microbiology 2022Quote: ... anti-His×6 (mouse monoclonal, Invitrogen, 1:10,000-20,000), anti-OmpA (rabbit polyclonal ...
-
bioRxiv - Immunology 2023Quote: ... post-dose 3 and 6-months post-dose 3 using mouse anti-human IgG1 biotin (Thermo Fisher Scientific) and mouse anti-human IgG4 biotin (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2021Quote: ... two SlP4H3 OEX lines (#1, #2) and three SlP4H3 RNAi lines (#1, #6 and #7) by using the TRI reagent (Thermo Fisher Scientific, Waltham, MA, USA). Reverse transcription of approximately 1 μg of total RNA was performed with Superscript II® Reverse Transcriptase (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: AML cells (6 x104 cells/cm2) were seeded for 24h on poly-D-Lysine (Gibco) coated Lab-Tek II Chamber Slides (Nunc ...
-
bioRxiv - Plant Biology 2020Quote: ... QuantStudio 6 (Thermo Scientific) and specific primers ...
-
bioRxiv - Plant Biology 2020Quote: ... 6-mercaptopurine (Fisher Scientific), 5-fluorouracil (Fisher Scientific) ...
-
bioRxiv - Neuroscience 2021Quote: ... Il-6 (ThermoFisher, Mm00446190_m1), Nlrp3 (ThermoFisher ...
-
bioRxiv - Neuroscience 2019Quote: ... Fugene 6 from Invitrogen.
-
bioRxiv - Cell Biology 2019Quote: ... Sas-6 (Thermofisher, Switzerland) – GCACGUUAAUCAGCUACAAdTdT (Leidel et al. ...
-
bioRxiv - Immunology 2021Quote: ... 6 mM MgCl2 (Ambion), 1 μM TSO-primer* (Metabion) ...
-
bioRxiv - Neuroscience 2021Quote: ... Amira Software 6 (ThermoFisher) was used for all 3D renderings ...
-
bioRxiv - Neuroscience 2020Quote: ... Il-6 (ThermoFisher, Mm00446190_m1), Tnf-α (ThermoFisher ...
-
bioRxiv - Immunology 2021Quote: ... Il-6 (Mm00446190_m1, ThermoFisher) and TNF-α (Mm00443258_m1 ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-multiwell plate (ThermoFisher) in E8 medium containing 10 μM Y-27632 (#Y0503 ...
-
bioRxiv - Cell Biology 2024Quote: ... and 6% DMSO (Invitrogen). Each tissue organoid cryovial is barcoded with sample attributes and are assigned storage using RLIMS (Research Laboratory Information Management System) ...
-
bioRxiv - Pathology 2023Quote: ... using QuantStudio 6 (ThermoFisher). Relative mRNA levels were quantified by the ddCT method ...
-
bioRxiv - Neuroscience 2023Quote: ... interleukin 6 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... IL-6 (Thermo Fisher), and IL-2 (BioLegend ...