Labshake search
Citations for Thermo Fisher :
1801 - 1850 of 10000+ citations for 6H Dibenzo b d pyran 3 pentanaminium 6a 7 10 10a tetrahydro 1 hydroxy N N N 6 6 9 hexamethyl 6aR trans 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2020Quote: All 7 gills from each individual shrimp (5 ≤ N ≤ 8) were dissected under a magnifying lens with micro-scissors and homogenized in TRIzol reagent (Life Technologies, Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... EC-N-Cdh protein purified from wild type and ΔPOMGnT1 HEK293T cells (see above) was incubated with pre-washed Dynabeads™ (Invitrogen) at a ratio of 40 μg of protein per 40 μl of bead suspension o/n at 4 °C ...
-
bioRxiv - Microbiology 2021Quote: ... Approximately 2.5 μg of the in vitro synthesized RNA was used to transfect ∼6 ×105 BHK-hACE2-N cells stably expressing the SARS-CoV-2 N and the human ACE2 genes(Rihn et al., 2021) using the MessengerMax lipofection kit (Thermo Scientific) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... and contained 5 µl PowerUp SYBR Green Master Mix with UNG (uracil-N glycosylase to prevent carryover contamination; Thermo Fisher Scientific), 1 µM (panC ...
-
bioRxiv - Biophysics 2021Quote: Human wild type ABCG2 or ABCG2 R184A containing an N-terminal Flag-tag was expressed in HEK293-EBNA (Thermo Fisher Scientific) cells as previously described19 ...
-
bioRxiv - Cell Biology 2021Quote: ... The pcDNA5/FRT-PRPF4 plasmid was constructed by cloning the PRPF4 gene fused to an N-terminal FLAG/HA tag into the pcDNA5/FRT plasmid (Thermo Fisher).
-
bioRxiv - Cell Biology 2022Quote: ... lines were generated in HEK293T cells expressing retroviral packaging plasmids (gift from N. Montserrat) and transfected using Lipofectamine™ 3000 Transfection Reagent (Invitrogen).
-
bioRxiv - Immunology 2022Quote: ... we resuspended cells at a concentration of 1000 cells/µL and added 1µl of RNase Inhibitor (Invitrogen, Cat. N.10777-019) before loading the mix on a Chromium Comptroller Instrument (10x Genomics) ...
-
bioRxiv - Biochemistry 2022Quote: ... was cloned in frame with a N-terminal GFP tag and intervening short peptide linker (GSGEGRG) into the pcDNA5/FRT/TO bacterial expression vector (Invitrogen; V652020). A C-terminal histidine tag (Hisx6 ...
-
bioRxiv - Microbiology 2020Quote: ... cells were immunofluorescently labelled for viral N-protein (detected with AlexaFluor488 or AlexaFluor546 conjugates) followed by RNA visualisation using the ViewRNA Cell Plus Kit (Thermo Fisher). The ViewRNA probes implemented targeted IL-6 (VA4-19075 ...
-
bioRxiv - Microbiology 2020Quote: ... a codon optimized cDNA sequence for the ORF of SARS-CoV-2 N (NCBI reference sequence number: NC_045512) was cloned into the pEGFP-C1 (by GeneArt-Thermo Fisher Scientific). Once cloned ...
-
bioRxiv - Immunology 2021Quote: ... GenBank: QHD43416.1) with an N-terminal IgKappa signal sequence (METDTLLLWVLLLWVPGSTG) and C-terminal TwinStrep- and 3xFLAG-tags (GeneArt, ThermoFisher, Regensburg, Germany) into a pcDNA3.4(+ ...
-
bioRxiv - Cell Biology 2020Quote: ... 100 μg of anti-rabbit IgG was incubated with 8 μg of Alexa Fluor 750 N-Succinimidyl Ester (Thermo Fisher Scientific) in 100 mM NaHCO3 (pH 8.3 ...
-
bioRxiv - Microbiology 2021Quote: ... A549 cells were transiently co-transfected with 100 ng in total of an N- or C-terminal LgBiT and SmBiT tagged construct using Lipofectamine™ 3000 Transfection Reagent (ThermoFisher). All possible combinations of the N-terminal and C-terminal-tagged split luciferase protein pairs were tested ...
-
bioRxiv - Immunology 2022Quote: ... were washed with 100 mM monobasic sodium phosphate pH 6.2 and activated by addition of Sulfo-N-Hydroxysulfosuccinimide (Thermo Fisher Scientific) and 1-Ethyl-3-(3-dimethylaminopropyl ...
-
bioRxiv - Plant Biology 2020Quote: ... and the percentage of C and N per sample was calculated with the instrument’s software (Eager Smart, Thermo Scientific, Walham, MA). Biomass and percent N values were multiplied to estimate total N in plant tissues.
-
bioRxiv - Microbiology 2019Quote: ... The viral N-protein was labeled using a primary anti-Tula virus antibody(12) and a secondary anti-rabbit FITC conjugate (Invitrogen, USA). The viral Gc protein was stained using a mouse monoclonal antibody (#H1808-60B ...
-
bioRxiv - Neuroscience 2019Quote: pLVX-EF1a-TS-EGFP-IRES-Puro was cloned by introducing an N-terminal Twin-Strep (TS)-tagged EGFP cDNA (DNA String byGeneArt, Life Technologies) into the EcoRI and BamHI sites of pLVX-EF1a-IRES-Puro (Clontech ...
-
bioRxiv - Neuroscience 2019Quote: ... pLVX-EF1a-TS-OPT-FUS-IRES-Puro was cloned by introducing an N-terminal Twin-Strep (TS)-tagged codon optimized FUS cDNA (Gene synthesis by GeneArt, Life Technologies) into the EcoRI and BamHI sites of pLVX-EF1a-IRES-Puro (Clontech ...
-
bioRxiv - Biochemistry 2021Quote: For the first set of experiments we used the Nunc™ MicroWell™ 96-Well Microplates (ThermoFisher Scientific, cat. n. 269620) with Nunc™ Microplate Lids (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: 100,000 cells for SK-N-SH and IC-pPDXC-63 cell lines were plated in a 4-well Lab-Tek chamber (Cat# 177399PK, Thermo Fisher) 48 hours before immunostaining ...
-
bioRxiv - Cell Biology 2020Quote: C2C12 myoblasts were transfected with a plasmid containing the N-terminal 88 amino acids of human cyclin B1 fused to EGFP using Lipofectamine 3000 (Invitrogen, L3000001) with the P3000 reagent according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... and human CMP-N-acetylneuraminate-poly-α-2,8-sialyltransferase (ST8SIA4) (NP_005659)were codon-optimized for human expression and synthesized (Geneart, Thermo Fisher Scientific). A cDNA encoding a soluble version of human NCAM ...
-
bioRxiv - Cell Biology 2019Quote: Whole cell extracts of cultured cells were lysed in 1.5% n-dodesylmaltoside (Roth) in PBS supplemented with protease and phosphatase inhibitor cocktail (Thermo Fisher Scientific) as described (Fernandez-Mosquera et al. ...
-
bioRxiv - Microbiology 2019Quote: ... Species was confirmed by amplifying a region of mitochondrial DNA using the primers C1-J-2495 and C1-N-2800 (Wells and Sperling, 2001) and Platinum Taq DNA polymerase (Life Technologies) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... NP presenting BG505 V1V2 and a trimeric scaffold (1TD0) presenting ZM109 V1V2 were transiently expressed in N-acetylglucosaminyltransferase I-negative (GnTI-/-) HEK293S cells (Thermo Fisher) (41) ...
-
bioRxiv - Biochemistry 2021Quote: ... the N-terminal His-tagged protein was purified in a single step protocol using HisPur Ni-NTA resin (Thermo Fisher Scientific), equilibrated at RT ...
-
bioRxiv - Immunology 2021Quote: ... were cloned into pCEP4 mammalian expression vector containing N-terminal human Ig kappa leader sequence and C-terminal Avi-tag and His-tag (Invitrogen, USA). Expi293-Freestyle cells cultured at 37°C and 8% CO2 in growth medium containing Expi293 Expression Medium at 3×106/mL in 50 mL media were transfected overnight at 37 °C with 50μg of plasmid in 160μL of ExpiFectamine plus 6mL of OptiMEM-I (all from Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... total RNA from testicular explants (n = 20 males) was extracted by using the commercial RNAqueous®-Micro kit (Ambion, Austin, USA), according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2021Quote: ... and a 50 cm analytical column (Acclaim PepMap 100, 75 μm x 50 cm, C18, P/N ES803, Thermo Fisher Scientific). The injection volume was 2 μL out of 18 μL in which the samples were dissolved in the autosampler ...
-
bioRxiv - Cell Biology 2020Quote: Recombinant 6XHis-tagged TbVps24 (N-terminus tag) was cloned using the pTrcHis TOPO TA expression system (Thermo Fisher Scientific, Carlsbad, CA) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Viral N protein was detected using a rabbit anti-SARS-CoV N antibody [32] as a primary antibody with AlexaFluor 568 anti-rabbit IgG or anti-rabbit IgG-HRP (Thermo Fisher) as secondary antibodies together with DAPI to stain the nucleus by indirect immunofluorescence as described previously [33].
-
bioRxiv - Microbiology 2021Quote: ... reverse:CCATCCAATCGGTAGTAGCG) or the SARS-CoV-2 N gene (forward: TTACAAACATTGGCCGCAAA, reverse: GCGCGACATTCCGAAGAA) and Power SYBR Green PCR Master Mix (Applied Biosystems) were used to amplify cellular RNA and viral RNA by QuantStudio 6 Flex Real-Time PCR Systems (Applied Biosystems) ...
-
bioRxiv - Biochemistry 2020Quote: Whole-cell lysates were obtained incubating cell pellets with a Lysis Buffer (2% n-dodecyl β-dmaltoside (DDM) (Thermo Scientific, #89903) plus 1X protease inhibitor cocktail (Roche ...
-
bioRxiv - Biophysics 2022Quote: ... and pcDNA3.1(+)-N-HA-RTEL1-ΔHHD1+2) (Supplementary Table S3) were transfected using Lipofectamine® 2000 reagent (Invitrogen; Cat. No.11668019) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... Synthetic peptides were coupled to rabbit serum albumin (RSA) with the linker Sulfo-m-maleimidobenzoyl-N-hydroxysuccinimide ester (Sulfo-MBS, Thermo Scientific) in a carrier (1):linker (50):peptide (50 ...
-
bioRxiv - Plant Biology 2022Quote: The full-length coding sequence of the genes were cloned into pSPYNE-35SGW (N-terminal YFP) and/or pSPYCE-35SGW (C-terminal YFP) through gateway cloning (Invitrogen™). BiFC was carried out as described (Gou et al. ...
-
bioRxiv - Microbiology 2022Quote: ... Approximately 2.5 µg of the in vitro synthesized RNA was used to transfect ∼6 ×105 BHK-hACE2-N cells stably expressing the SARS-CoV-2 N and the human ACE2 genes [65] using the MessengerMax lipofection kit (Thermo Scientific) as per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... The samples were dried at 70°C for at least 20 h and the total N (% g dry weight [DW]) and 15N (atom%) contents were analyzed using a Flash2000-DELTAplus Advantage ConFlo? System (ThermoFisher Scientific) at Shoko Science Co. ...
-
bioRxiv - Neuroscience 2023Quote: ... SCOs were washed o/n in 1x PBS and cryopreserved gradually in sucrose before being embedded (TissueTek OCT, Fisher Scientific, 10690461) and flash-frozen on dry-ice ...
-
bioRxiv - Neuroscience 2022Quote: ... the muscle layer of the gut was extracted using a forceps n.4 (FST, Germany, EU) and placed in Hank’s buffer solution (HBSS) (Invitrogen, Germany, EU). The tissue was then incubated in Collagenase I (Worthington ...
-
bioRxiv - Neuroscience 2022Quote: ... sympathetic ganglia were extracted using a forceps n.4 (FST, Germany, EU) and placed in Hank’s buffer solution (HBSS) (Invitrogen, Germany, EU). The tissue was then incubated in Collagenase I (Worthington ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were co-transfected with 3.6 μg of pOG44 and 400 ng of either N- or C-terminal pDEST-pcDNA5-c17orf80-BirA*-FLAG using Lipofectamine 2000 (Invitrogen; 11668019) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... and its N-terminal amino-acid sequence was analyzed by Edman microsequencing(39) on a Procise 494 cLC protein sequencer (Applied Biosystems), using the standard pulsed-liquid program for PVDF-blotted proteins.
-
bioRxiv - Microbiology 2022Quote: SpRecAA488 was made by covalently modifying primary amines (lysines or N-ter) of the protein with Alexa 488-succinidimyl ester (Molecular Probes, ThermoFisher), in presence of an excess of ssDNA (M13 mp18 ...
-
bioRxiv - Cell Biology 2024Quote: ... Cnn or TACC CDS were recombined with a destination pRNA vector containing a GFP CDS at either the N- or C-terminus using Gateway technology (ThermoFisher Scientific).
-
bioRxiv - Neuroscience 2024Quote: PVN tissue biopsies were collected from fresh-frozen brain tissue and protein extracted using Neuronal Protein Extraction Reagent (N-PERTM, Thermo Scientific) for determination of CRH protein levels by Western Blot ...
-
bioRxiv - Neuroscience 2024Quote: ... zebrafish larvae from visually similar developmental stages were collected in groups of 16 individuals from all corresponding genotypes (N = 4-5 per genotype) and stored in RNAlater (Thermo Fisher) until use ...
-
bioRxiv - Neuroscience 2024Quote: ... Neuronal differentiation was induced by culturing NGN2-NPC in neural differentiation medium (DMEM/F-12 + Glutamax, Gibco®; 1x N-2 supplement, Gibco® ...
-
bioRxiv - Developmental Biology 2024Quote: HEK293T cells were transferred with C-terminal HA-tagged Kayak and N-terminal GFP-tagged Jun-epi or Kayak using Lipofectamine 2000 (11668030, Thermo Fisher). The GFP-trap agarose beads (ABIN509397 ...