Labshake search
Citations for Thermo Fisher :
1701 - 1750 of 10000+ citations for 6H Dibenzo b d pyran 3 pentanaminium 6a 7 10 10a tetrahydro 1 hydroxy N N N 6 6 9 hexamethyl 6aR trans 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... zipper tag via a 5XGGS linker region was co-transfected with N-terminally His-tagged human Leptin in suspension HEK293 FreeStyle cells (ThermoFisher) in the presence of 20 μM kifunensine (Dextra ...
-
bioRxiv - Cell Biology 2023Quote: ... Domes were polymerised by incubation for 15 minutes at 37°C and Advanced DMEM media supplemented with 1x N-2 (Gibco), 1x B-27 (Gibco) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.1M Tris-base in DEPC H2O) and 1X PBS for 5 min each before being blocked using 100 mM N-succinimidyl acetate (NHS-acetate, ThermoFisher) in NHS-acetate buffer (0.1M NaP ...
-
bioRxiv - Molecular Biology 2023Quote: ... and from the liver graft of living donors (N=4) were obtained at the time of liver transplantation and stored frozen in RNAlater solution (Invitrogen). ABCB4 pathogenic mutations were documented in all PFIC3 by genetic analysis ...
-
bioRxiv - Immunology 2023Quote: ... and stained for SARS-CoV-2 N protein using Biotin-labelled-CR3009 antibody produced in-house together with a Streptavidin-Alexa488 (S32354, Invitrogen) and cellular DNA using DAPI (10236276001 ...
-
bioRxiv - Physiology 2023Quote: ... and clinical CRS-isolates (Drs. N. Cohen and L. Chandler, Philadelphia VA Medical Center [56]) were grown in Luria broth (Gibco). For anti-bacterial assays ...
-
bioRxiv - Pathology 2023Quote: ... LMD samples (n=5 for each sample structure) were pooled by adding 60 μl of acetonitrile (10055454, Thermo Fisher Scientific) to each tube and spun down ...
-
bioRxiv - Bioengineering 2022Quote: ... formalin-fixed fibrotic capsule tissue samples (n=2 per group) and subcutaneous tissue samples (n=2) were placed in a solution of 2 mg/ml FITC (Invitrogen) in DMEM/F12 media (Gibco) ...
-
bioRxiv - Biophysics 2023Quote: ... Cy3B and AF647 free dyes were prepared by hydrolyzing the corresponding NHS ( N-hydroxysuccimidyl) esters (PA63101, Cytiva, and A200006, Invitrogen) in 0.1 M sodium bicarbonate overnight ...
-
bioRxiv - Cell Biology 2023Quote: Generation of replication-defective recombinant adenovirus expressing N-SREBPs under CMV promoter was performed using ViraPower Adenoviral Expression System (#K4930-00, Invitrogen) as described earlier (54) ...
-
bioRxiv - Bioengineering 2023Quote: ... They were cultured on 100-mm Petri dishes coated with human VTN-N truncated recombinant protein (Gibco, Thermo Fisher Scientific). The hiPSCs obtained from Thermo Fisher Scientific were maintained in Essential 8 Medium (Gibco ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293 cells stably expressing N-terminally FLAG-tagged DOR or MOR were cultured in the presence of 250 μg/ml Geneticin (Gibco). For transient DNA expression ...
-
bioRxiv - Bioengineering 2023Quote: ... They were cultured on 100-mm Petri dishes coated with human VTN-N truncated recombinant protein (Gibco, Thermo Fisher Scientific). The hiPSCs obtained from Thermo Fisher Scientific were maintained in Essential 8 Medium (Gibco ...
-
bioRxiv - Neuroscience 2023Quote: ... 30 mg of tissue per sample was homogenized in N-PER Neuronal Protein Extraction Reagent (Thermo Fisher Scientific, Cat. # 87792) with protease and phosphatase inhibitors (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... For C-terminal fusions the CDS of PYE and OLV versions were amplified from cDNA of Fe deficient Arabidopsis WT roots with primer pairs PYE_B1 fw/PYEns_B2 rev and OLV_B1 fw/OLVns_B2 rev carrying B1 and B2 attachment sites without stop codon or from existing pDONR with N-terminal fusion (Supplemental Table S1) and transferred via Gateway cloning into pDONR207 (Invitrogen) according to the manual (Gateway ...
-
bioRxiv - Microbiology 2023Quote: ... N (75 fmol) and L (25 fmol) proteins and the T7 RNA polymerase (50 fmol) using lipofectamine 3000 (Invitrogen™) for 3 h at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The flow-through was dialysed O/N at 4°C in a SnakeSkin™ Dialysis Tubing (3.5K MWCO, Thermo Scientific) against dialysis buffer (50 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Bioengineering 2023Quote: Blood plasma extracted from each group (n=5) was analyzed using the Inflammation 20-Plex Human ProcartaPlex™ Panel (Invitrogen). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: ... A 6xHis-myc tag or GFP was attached to the N-terminus and the construct was cloned into the pSecTag2A vector (Invitrogen) in frame with the N-terminal IgK signal sequence ...
-
bioRxiv - Genetics 2024Quote: ... Wild type N/TERT-2G cell line was cultured using EpiLife medium with 60 µM calcium (Gibco™, cat. #MEPI500CA), supplemented with human keratinocyte growth supplement (HKGS ...
-
bioRxiv - Molecular Biology 2023Quote: ... as already described [17] and reseeded onto 0.2 mm bone slices labelled with N-hydroxysuccinimide ester-activated rhodamine fluorescent dye (ThermoFisher Scientific), at a cell density of 1x105 cells/bone slice (Boneslices.com) ...
-
bioRxiv - Developmental Biology 2024Quote: The PROX1 cDNA was subcloned into pFASTBAC1 to express PROX1 with an N-terminal FLAG- tag in Sf9 cells by the baculovirus expression system (Invitrogen). The PROX1-FLAG protein was then purified on M2 agarose (Sigma) ...
-
bioRxiv - Biochemistry 2024Quote: ... was serial diluted using a solution containing 0.1% FA in LCMS grade water (Pierce 85170) and 0.1% n-Dodecyl-beta-Maltoside Detergent (DDM, Thermo Fisher, 89902). A total of 10 microliters of each dilution ...
-
bioRxiv - Biochemistry 2024Quote: BRSK1 and 2 were cloned into pDest vectors (to express N-terminal Flag or HA tagged proteins) using the Gateway LR Clonase II system (Invitrogen) as per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... The percentage of C and N were quantified using the FLASH 2000 Organic Elemental Analyzer (Thermo Fisher Scientific Villebon, France) and the 15N enrichment using the Delta V Advantage isotope ratio mass spectrometer (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... n=15 full larvae) or extracted from hCMEC/D3 cells seeded in 12 well/plates using a standard TRIzol (Invitrogen) method ...
-
bioRxiv - Biochemistry 2024Quote: ... The DNA synthesis of calpL fused with TEV-cleavable His6-StrepII-His6 tag at the N- or C-terminal and cloning into pBAD/HisA vector (Invitrogen) was ordered from Twist Bioscience ...
-
bioRxiv - Neuroscience 2024Quote: ... Full-length mouse GPR158 containing an N-terminal HA-tag or smURFP-tag were cloned into pcDNA3.1 (Thermo Fisher Scientific). Full-length cDNA encoding mouse PLCXD2 containing a C-terminal FLAG-tag in pcDNA3.1 (clone OMu06191 ...
-
bioRxiv - Cell Biology 2024Quote: ... WT and YAP1-KO EHTs were snap frozen in liquid nitrogen and stored at −80 °C before thawing them O/N at −20 °C in RNA LATER-ICE (ThermoFisher). RNA was extracted using High Pure RNA Isolation Kit (Roche ...
-
bioRxiv - Cell Biology 2024Quote: Protein concentrations of samples (fractions 6-9) were determined with a Pierce™ BCA Protein Assay Kit (ThermoFisher, Rockford, USA), and Bradford assay (Biorad ...
-
bioRxiv - Developmental Biology 2023Quote: ... The precipitated pellets containing the cumulus-oocyte complexes (COCs) were transferred to a 9 cm Petri dish and 6 ml of wash medium (TCM 199 - GIBCO, buffered with 2.5% HEPES ...
-
bioRxiv - Bioengineering 2021Quote: ... a 6 well plate containing 6 mL FACS Clean (Thermo Fisher, BD 340345), 6 mL FACS Rinse (Thermo Fisher ...
-
bioRxiv - Cell Biology 2021Quote: ... and labelled with 0.7 μM 6-carboxyfluorescin dictate (6-CFDA; Thermo Fisher Scientific) for 30 minutes at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... high dose IL-6 stimulation received 100 ng/ml IL-6 (Gibco; PHC0066) or 100 pM acetic acid vehicle stimulation for either 3-or 24-hours and immediately collected for analysis ...
-
bioRxiv - Biophysics 2019Quote: The samples of 40-nm diameter dark red fluorescent beads deposited on a coverslip (Supplementary Fig. 6a, Supplementary Fig. 7) were obtained by diluting the initial solution (10720, Thermo Fisher) at 5.10−7 in PBS + 5% glucose ...
-
bioRxiv - Neuroscience 2022Quote: ... Tax ID 10090) protein database (2017-6-7) using Proteome Discoverer (PD) 2.2 (Version 2.2.0.388; Thermo Fisher Scientific). Label-free quantification was also performed with PD 2.2 using precursor ions quantifier nodes ...
-
bioRxiv - Genomics 2021Quote: ... qPCR was performed on Viia 6/7 Real time PCR system using SYBR Green master mix (Life Technologies). The primers used are listed in Supplementary table 1 ...
-
bioRxiv - Cell Biology 2021Quote: ... These experiments were carried out with the QuantStudio 6 and 7 Flex Real-Time PCR Systems (Applied Biosystems). Expression of circRNAs was calculated relative to the housekeeping genes 18S or ACTB ...
-
bioRxiv - Cell Biology 2024Quote: ... Z-stack images were taking on day 6-7 after seeding using EVOS™ 7000 Imaging System (Invitrogen). and used for quantification of organoids.
-
bioRxiv - Microbiology 2024Quote: ... Propidium iodide (PI) and the pH sensitive 2’,7’-Bis-(2-Carboxyethyl)-5-(and-6)-Carboxyfluorescein (BCECF) (Invitrogen) were added to these at a final concentration of 100µM and 10µM respectively ...
-
bioRxiv - Bioengineering 2023Quote: ... HUVECs were cultured for 6-7 days prior to detachment with 0.25% trypsin-EDTA (Life Technologies, 25200-056) for use in experiments ...
-
bioRxiv - Immunology 2023Quote: ... iGB cells were collected after 6-7 days on iGC culture and were stained with Fura-2 (Invitrogen) at 1μM / ml ...
-
bioRxiv - Bioengineering 2023Quote: ... HUVECs were cultured for 6-7 days prior to detachment with 0.25% trypsin-EDTA (Life Technologies, 25200-056) for use in experiments.
-
bioRxiv - Plant Biology 2024Quote: ... Data was analysed with QuantStudio 6 and 7 Pro Real-Time PCR Systems Software (Thermo Fisher Scientific, America). For RT-qPCR ...
-
bioRxiv - Physiology 2023Quote: ... For cell viability assays 7-AAD (7-Aminoactinomycin D, Invitrogen, A1310) and Hoechst 33342 (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... supplemente d with B-27 (Invitrogen) and plated onto eight-well culture slides (BD Biosciences ...
-
bioRxiv - Bioengineering 2020Quote: ... 3) latrunculin-b (Lat-B; 2 μM; Fisher Scientific), 4 ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
Validating Minimally Invasive Laser Doppler Flowmetry for Serial Bone Perfusion Measurements in MicebioRxiv - Bioengineering 2019Quote: Systemic inflammation was examined by quantifying serum concentrations of the proinflammatory marker interleukin 6 (IL-6) with an ELISA (IL-6 Mouse ELISA kit, KMC0061, Invitrogen, Carlsbad, CA). Samples were prepared according to the manufacturer’s instructions and measured using a plate reader (Synergy H1 ...
-
bioRxiv - Genetics 2023Quote: 3 independent total RNA extractions from 30 ovaries from 3-6-day-old RevI-H2i2 flies using Trizol (Invitrogen) were performed ...