Labshake search
Citations for Thermo Fisher :
1051 - 1100 of 10000+ citations for 2' 3' cGAMP STING based FRET Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... All transcripts were treated with DNase and purified by column-based purification (ThermoFisher PureLink RNA Mini Kit). To produce dsRNA or Alu(+):Alu(- ...
-
bioRxiv - Molecular Biology 2022Quote: Magnetic beads-based extraction was performed using the Dynabeads DNA DIRECT Blood kit from Invitrogen (Life Technolgies) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... supernatant was collected and ATP content was quantified using the luciferase-based ATP Determination Kit (Invitrogen, A22066) following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2024Quote: ... The resulting cDNA was isolated via column-based purification using the GeneJet Gel Extraction Kit (Thermo Scientific). To generate dsDNA for sequencing using the cDNA as template ...
-
bioRxiv - Cell Biology 2020Quote: ... incubated 2-3 minutes with SuperSignalTM West Pico Chemiluminiscent Substrate (Thermo Scientific) and imaged using C-DiGit® Blot Scanner (LI-COR).
-
bioRxiv - Microbiology 2019Quote: ... and 2 μl of 1 μM ToPro 3 (Molecular Probes T-3605), a nucleic acid dye that only permeates cell membranes of dead cells ...
-
bioRxiv - Biochemistry 2020Quote: 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Thermo Fisher Scientific) was added to cells at a final concentration of 2mM and incubated at 37°C in 5%CO2 for 1 h ...
-
bioRxiv - Biochemistry 2021Quote: ... A predesigned TaqMan assay targeting exon 2–3 boundary (Hs00213726_m1; Life Technologies) was also used to ensure equal amount of the endogenous A4GALT transcript in transfected and non-transfected cells ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-phospho-Pak1-2-3 (pSer141) (44-940G, 1:2000) from Invitrogen/Thermo Fisher Scientific (Carlsbad ...
-
bioRxiv - Cell Biology 2021Quote: ... Jade1/2/3 mRNA was assessed by SYBR Green (Thermo Fisher Scientific) qPCR using Hprt1 as endogenous control ...
-
bioRxiv - Cell Biology 2021Quote: ... phospho-PAK1/2/3 (Thr402) (ThermoFisher PA1-4636, 1:1000 for WB), phospho-PAK4 (Ser474)/PAK5 (Ser602)/PAK6 (Ser560 ...
-
bioRxiv - Cell Biology 2021Quote: ... and were passaged every 2 or 3 days using 0.05% Trypsin (Gibco). mESCs were used at passages below 30 ...
-
bioRxiv - Neuroscience 2020Quote: ... Fibroblasts were fed every 2-3 days with DMEM (ThermoFisher Scientific, #11995073) media supplemented with 10% (v/v ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were passaged once every 2-3 days by trypsinization (Gibco, 25300054) upon reaching ∼70-80% confluency ...
-
bioRxiv - Physiology 2020Quote: ... for 3 days with macrophage-conditioned medium containing 2% Horse Serum (Gibco). Cells were washed ...
-
bioRxiv - Cell Biology 2019Quote: ... which were activated through consecutive incubation with 2% 3-aminopropyltrimethoxysilane (Acros Organics) in isopropanol for 15 min at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... spiked with 2-3 μL Plus reagent (15338100, Thermo Fisher Scientific, USA). The plasmid solution was mixed and incubated for 10 min at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... Dynabeads with precipitated proteins were washed 3 times with DynaMag-2 (Invitrogen) and eluted with LDS buffer (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... This medium was exchanged 2-3 hours after plating with Neurobasal (Gibco) supplemented with L-glutamine (2 mM) ...
-
bioRxiv - Cell Biology 2023Quote: ... 2- & 3-methyl pentane and n-hexane (Thermo Scientific, Waltham, MA, USA). Reported compounds detected by the GC-MS were confirmed by matching retention times and mass–charge (m/z ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were split every 2 to 3 days using TrypLE Express (Gibco).
-
bioRxiv - Immunology 2023Quote: ... 3) Dyes: NucBlue Live Cell Stain (2 drops/ml, R37605, Molecular Probes), phalloidin-568 (A12380 ...
-
Self-organised pattern formation in the developing neural tube by a temporal relay of BMP signallingbioRxiv - Developmental Biology 2023Quote: Cells were passaged every 2-3 days by incubation with Accutase (Gibco) for 2-3 min at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... and TaqMan assay reagents (Table 2) on the QuantStudio 3 (Applied Biosystems). Gene expression was normalized to GAPDH expression ...
-
bioRxiv - Microbiology 2020Quote: ... Centrifuge filter plate on top of a new well-plate (#2, wV 200 ul e.g. 269787, Nunc, Roskilde, DK) at 900 x g for 2 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... We used a variable-spacing multichannel pipette (Thermo E1-ClipTip 2-125 µL) to transfer 3.5 µL of each compound from the chemical library plate into assay plates (Nunc™ 4-well plates ...
-
bioRxiv - Immunology 2021Quote: ... on the QuantStudio 5 or QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific). Relative transcript levels were normalized to TATA-binding protein (Tbp ...
-
bioRxiv - Molecular Biology 2021Quote: ... and CAF-1 p60 (5′-AAUCUUGCUCGUCAUACCA-3′) were transfected using RNAi MAX (Invitrogen).
-
bioRxiv - Neuroscience 2020Quote: ... and 0.175 g/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Invitrogen). Alkaline phosphatase staining reaction was proceeded o/n at RT ...
-
bioRxiv - Genomics 2020Quote: ... or a positive control probe 5’-5Alexa488N/(ATA)8TUU (ATA)7-3’ (Invitrogen). Reactions were incubated in a water bath at 37°C for 2 hrs ...
-
bioRxiv - Cancer Biology 2020Quote: Non-targeting control (CTRL) (Dharmacon) 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion ...
-
bioRxiv - Bioengineering 2021Quote: ... or siRNA targeting CTNNB1 (siCTNNB1, targeting sequence 5′- CCACAGCUCCUUCUCUGAGUGGUAA -3’, ThermoFisher, Waltham, MA) were resuspended in 50 μL of Opti-MEM and incubated at room temperature for 30 min ...
-
bioRxiv - Developmental Biology 2019Quote: ... with 3 M Na-Acetate and linear polyacrylamide (5 mg/mL, Ambion®) overnight at −80°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3′-end fluorescent labeling of the RNAs with fluorescein-5-thiosemicarbazide (ThermoFisher Scientific) was done as previously reported (Grozdanov and Stocco ...
-
bioRxiv - Microbiology 2020Quote: ... 3 to 5 colonies were transferred in Mueller-Hinton broth (Thermo Scientific Oxoid) and adjusted to an optical density at 600nm (OD ...
-
bioRxiv - Immunology 2020Quote: Pieces of 3 mm3 tumors were submerged in 5 vol of RNAlater (Invitrogen) (n = 5 samples/group) ...
-
bioRxiv - Developmental Biology 2020Quote: 3 × 106 ESC cells were distributed to 5 12-well dishes (Thermo Scientific) with 5 × 105 mESC cells per well ...
-
bioRxiv - Immunology 2022Quote: ... 5 μl RNA (2ng/μg) and 3 μl of 5x Primer stock (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Amplifications were run on a QuantStudio 3 or 5 thermal cycler (Thermo Fisher) and results were analyzed using the instrument software ...
-
bioRxiv - Cell Biology 2023Quote: ... vector encoding a sgRNA targeting PAC (5′-TGTCGAGCCCGACGCGCGTG-3′) using Lipofectamine 2000 (Invitrogen). GFP positive cells were isolated by FACS two days after infection ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were passaged every 3-5 days using Accutase or ReleSR (ThermoFisher Scientific).
-
bioRxiv - Molecular Biology 2023Quote: ... 3 × 10-4 M MTG and 5% Protein-Free Hybridoma Media II (Gibco).
-
bioRxiv - Cell Biology 2021Quote: ... PDMPO [2-(4-pyridyl)-5-((4-(2-dimethylaminoethyl-amino-carbamoyl)methoxy)-phenyl)oxazole] (ThermoFisher Scientific, USA) was added to a final concentration of 330 µM ...
-
bioRxiv - Immunology 2020Quote: ... then labelled with 2’,7’-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluoresceinacetoxymethyl ester (Life Technologies, UK). Neutrophils were then added to wells under normoxia or hypoxia ...
-
bioRxiv - Cell Biology 2023Quote: ... Equal volume of SYTOX Green (5 μM final in HBSS without Ca+2/Mg+2, Invitrogen) was added to each sample and incubated in the dark for 10 min ...
-
bioRxiv - Neuroscience 2023Quote: ... MSD GOLD 96-well small-spot streptavidin-coated microtiter plates (Meso Scale Discovery, Rockville, MD) were treated with a blocking step of 1% casein-based PBS (Thermo Scientific, Waltham, MA) for approximately 1 hour ...
-
bioRxiv - Microbiology 2020Quote: ... Asaia1 (5’-AGC ACC AGT TTC CCG ATG TTA T-3’) and Asaia2 (5’-GAA ATA CCC ATC TCT GGA TA-3’) labeled with Alexa Fluor® 555 (Invitrogen). Tissues were visualized using Nikon ECLIPSE IVi microscope connected to a Nikon DIGITAL SIGHT DS-U3 digital camera.
-
bioRxiv - Neuroscience 2019Quote: ... sections were washed in PBS (5 × 3 minutes) and then incubated 3 hours in a cocktail of secondary antibodies conjugated to Alexa Flour dyes (Life Technologies) to tag the primary antibodies at a concentration of 1:500 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and scrambled control mimics (sense 5’ - mCmArUmArUmUrGmCrGmCrGmUrAmUrAmGrUmCrGC - 3’; antisense5’ - /5Phos/rGrCrGrArCrUrArUrArCrGrCrGrCrArArUrArUmGmG rU - 3’; IDT) were reverse transfected at 2nM using Lipofectamine RNAiMax (Life Technologies) according to manufacturer guidelines.
-
bioRxiv - Immunology 2023Quote: ... and 500 nM each of the forward primer and reverse primer (Table 3) with the following cycling conditions on either QuantStudio 3 or 5 Real-Time PCR systems (Applied Biosystems): 95°C for 2 min ...