Labshake search
Citations for Thermo Fisher :
1251 - 1300 of 10000+ citations for 2' 3' cGAMP STING based FRET Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... To this mixture we added glycerol 2-phosphate (3 M, Thermo Fisher Scientific) and (GT)15-SWCNTs (3.75 mg/L ...
-
bioRxiv - Genomics 2024Quote: ... Cells were passaged every 2-3 days using 0.25% trypsin-EDTA (#25200056, Gibco) to keep them below 80% confluency ...
-
bioRxiv - Cancer Biology 2023Quote: ... Capan-2 and BxPC-3 cell lines were cultured in RPMI medium (Gibco) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Genetics 2022Quote: ... The detection dye used was SYBR Green (2× KAPA SYBR FAST qBioline and Platinum SYBR Green from Invitrogen). Real-time PCR was carried out as follows ...
-
bioRxiv - Molecular Biology 2020Quote: ... The analysis protocol was modified based on the instruction sheet for Rhodamine 110-based proteinase substrates from Molecular Probes, Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... or DiD (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindodicarbocyanine perchlorate, aka DiIC18(5)) (Thermo Fisher #D307) at a final concentration of 4 μg/mL ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were washed 3 times in 5% Bovine Serum Albumin (BSA; ThermoFisher Scientific, 11423164) in PBS then incubated with primary antibody to H2AX (Ser139) ...
-
bioRxiv - Genomics 2019Quote: ... using TVN PCR reverse primer (5’-CAAGCAGAAGACGGCATACGATTTTTTTTTTTTTTTTTTVN-3’) and SuperScript III Reverse Transcriptase (Invitrogen), and then the reaction was stopped by heating at 70°C for 15min ...
-
bioRxiv - Cell Biology 2019Quote: ... 3 min each) and digested for 5 min with proteinase K (10μg/mL; Ambion). Tissue sections were allowed to hybridize overnight in a humid chamber at 65°C with 1 ng/µL of sense (negative probe ...
-
bioRxiv - Neuroscience 2019Quote: ... After 3 washes Hoechst 33258 nuclear stain (ThermoFisher H3569, 1:1500 for 5 min) was used to counter stain the nuclei ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μg mtDNA were digested with 3 ul DraI Fastdigest restriction enzyme (Thermo Scientific) at 37°C for 3h and extracted with 1 volume phenol-chloroform ...
-
bioRxiv - Microbiology 2022Quote: ... FAM-5=CAT CCA ATC AAA GAC ATT GCG A 3=-TAMRA (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2021Quote: ... Coverslips were washed 3 × 5 min and mounted on slides using Prolong Gold (Invitrogen). Deconvolution wide-field microscopy was performed using the DeltaVision Elite system equipped with an NA 1.42 60x PlanApo objective (Olympus ...
-
bioRxiv - Cell Biology 2022Quote: ... CCDC66 was depleted using an siRNA with the sequence 5′-CAGTGTAATCAGTTCACAAtt-3′ (Thermo Scientific). Silencer Select Negative Control No ...
-
bioRxiv - Cell Biology 2023Quote: ... CCDC15 was depleted using an siRNA with sequence 5′-GCAGUACCUGAGACAUAGAtt-3′ (Ambion, Cat. # s36888). For depletion of POC5 ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were passaged every 3-5 days as necessary using 0.5mM EDTA (Thermo Fisher). All staining and qPCR experiments included in Figure 1 were carried out in H1 and H9 stem cells ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5’ TCTTGCGGCTTTGTTGACAC 3’) using SYBR™ Green PCR Master Mix (Applied Biosystems, Bedford, MA). The quantities measured by real-time PCR were normalized to the Rpl13 (5’GGCGGACCGATTCAATAAGGTTCTGATCATTG 3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... The following siRNA target sequences were used: GTPBP5 siRNA: 5’-CGGUGGACACGUCAUUCUGTT-3’ (134621, Ambion); GTPBP7 siRNA ...
-
bioRxiv - Immunology 2024Quote: ... tonsils were rinsed 3 x 5 minutes with 1X PBS (10010023, ThermoFisher Scientific, USA) without agitation ...
-
bioRxiv - Genomics 2024Quote: ... and a QuantStudio 3 or QuantStudio 5 Real-Time PCR instrument (Applied Biosystems™). Primers used for qPCR are listed in Suppl ...
-
bioRxiv - Cell Biology 2024Quote: ... si-PRELID1: 5’-CCCGAAUCCCUAUAGCAAA-3’) were transfected using Lipofectamine RNAiMAX (Thermo Fisher Scientific, 13778075). Assays were normally carried out 48 h after transfection ...
-
bioRxiv - Cancer Biology 2021Quote: ... Precipitated RNAs were quantified using Taqman miRNA assays with custom primers for detection of 5’-tRFCys (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2020Quote: S phase status was monitored by measuring 5-ethynyl-2’-deoxyuridine (EdU) incorporation with the Click-iT™ Plus EdU Alexa Fluor 488 Flow Cytometry Assay Kit (ThermoFisher, C10632) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: Young seedlings were incubated in 20 μM 5-ethynyl-2’-deoxyuridine (EdU) (Click-iT™ EdU Alexa Fluor™ 488 Flow Cytometry Assay Kit, ThermoFisher Scientific/Invitrogen ...
-
bioRxiv - Genetics 2020Quote: Proteins were extracted form 20 μL of ammonium bicarbonate resuspended fractions by adding 5 μL of lysis buffer (10% NP40, 2%SDS in PBS) and quantified by BCA protein assay kit (ThermoFisher Scientific, 23225).
-
bioRxiv - Neuroscience 2022Quote: ... except that they also received 2 injections of 10 mg/kg 5-ethynyl-2’-deoxyuridine (EdU) from the Click-iT EdU Alexa Fluor 647 imaging kit (Invitrogen, Carlsbad, CA), the day after DOX injection (4 DPN ...
-
bioRxiv - Bioengineering 2022Quote: ... 2.2 mM LAP was added to half of the samples and 10 µM 5-ethynyl-2’-deoxyuridine (EdU) solution from a Click-iT Plus EdU Cell Proliferation Kit (cat. no. C10637; Invitrogen, Waltham, MA) was added to the other half according to manufacturer instructions ...
-
bioRxiv - Systems Biology 2023Quote: ... HeLa spheroids were serum-starved for 4h by an initial wash in 200 µl (96-well plate) or 3 ml (24-well plate) DMEM high-glucose (Thermo Fisher Scientific #41966-029) supplemented with another 2 mM of L-Glutamine ...
-
bioRxiv - Neuroscience 2022Quote: ... the percentage of apoptotic astrocytes was evaluated using CellEvent Caspase-3/7 Green Detection Reagent (1:250; Thermo Fisher, cat. #C10423) added directly to the medium ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were then resuspended in DMEM + 10% FBS supplemented with 50 μM CellEvent™ Caspase 3/7 Green Detection Reagent (Invitrogen) at 37 °C for 25 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... At time of treatment the cells were also treated with 2μM CellEvent caspase-3/7 green detection reagent (C10423; Invitrogen, ThermoFisher Scientific, Inc), which was used to measure apoptosis ...
-
bioRxiv - Cancer Biology 2022Quote: ... RT-qPCR was performed using the QuantStudio 3 Detection System (QuantStudio Design and Analysis Software, Applied Biosystems, Foster City, CA, USA) and relative expression was calculated using the ΔCT method.
-
bioRxiv - Neuroscience 2022Quote: To analyze effector caspase activity in stimulated hippocampal neurons we employed the CellEvent(tm) caspase-3/7 green detection assay (ThermoFisher Scientific) that allows analyzing activity in individual cells ...
-
bioRxiv - Biophysics 2023Quote: ... the media was removed and the cells were incubated with 8 µM CellEventTM Caspase 3-7 green detection reagent (Thermo Fisher) in PBS containing 5% FBS for 30 min at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... BAL samples were then centrifuged at 3,000 g for 20 min to collect cells and ApoBDs for staining with a combination of SR-DEVD-FMK (caspase 3/7 activity detection dye, Thermo Fisher), annexin A5-V450 and TO-PRO-3 in 1× A5 binding buffer at room temperature for 10 min ...
-
bioRxiv - Biochemistry 2023Quote: ... tRNAGln was 3’ biotin labeled with the Pierce ™ RNA 3’ end biotin labeling kit (Thermo Fisher) according to manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2021Quote: ... We isolated neonatal cardiomyocyte (postnataTl 2 – 3 days) from Gja1M213L/M213L and Wildtype (WT) mice using PierceTM Primary Cardiomyocyte Isolation Kit (Thermo Fisher Scientific, Walthman, MA) following manufacturer protocol ...
-
bioRxiv - Immunology 2023Quote: ... D1-3 and D4-5 proteins were fluorescently labelled with Alexa Fluor™ 594 or 488 Microscale Protein Labeling Kits (Invitrogen™, A30008 or A30006) as described [15] ...
-
bioRxiv - Microbiology 2022Quote: Hemolytic activity was assessed by spotting 5 μL of growing cells on Columbia agar plates supplemented with 5% defibrinated horse blood (Thermo Scientific), incubated for 24h at 37°C and analyzed for the presence of a lysis halo around the colony.
-
bioRxiv - Microbiology 2023Quote: ... Columbia colistin and nalidixic acid (CNA) agar with 5% sheep blood (5%SB-CNA) and chocolate agar medium agar plates were purchased from Fisher Scientific.
-
bioRxiv - Genomics 2022Quote: DGs were dissected by removing the whole sting complex of a dry-ice anesthetized bee and placing it in a drop of RNAlater (Invitrogen, Carlsbad, CA) to keep the tissue cold and prevent degradation ...
-
bioRxiv - Cell Biology 2024Quote: ... They were then incubated overnight at 4 °C with the primary antibody (anti-TMEM173/STING antibody (OT14H1),1:100 dilution) (Invitrogen, MA,USA). After they were rinsed with PBS-T ...
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...
-
bioRxiv - Genomics 2020Quote: ... In case of the Fluidigm scRNA-Seq protocol 2 µL of each cell have been diluted in appropriate amounts of harvest dilution buffer based on prior picogreen (Thermo Fisher, P11496) cDNA concentration measurements for each cDNA cell sample ...
-
bioRxiv - Microbiology 2022Quote: ... The viral genome between 27,895-29,534 nucleotides based on the SARS-CoV-2 WA-1 strain was RT-PCR amplified using Super Script II Reverse transcriptase (Thermo Fisher Scientific) and Expanded High Fidelity PCR system (Sigma Aldrich) ...
-
bioRxiv - Developmental Biology 2019Quote: ... aliquots of 5 × 104 293FT cells were seeded onto poly-L-lysine (PLL)-coated 6-cm dishes and co-transfected with 2 μg of each pCAG-based expression vector using Lipofectamine 3000 (Thermo Fisher Scientific). After 48 hours ...
-
bioRxiv - Immunology 2019Quote: ... 1×106 (24-well plate) or 5×105 (48-well plate) CD8+ T-cells were activated with Dynabeads Mouse T-Activator CD3/CD28 (Thermo Fisher, 11456D) in a 1:1 beat to T-cell ratio and cultured in 2 ml (24WP ...
-
bioRxiv - Immunology 2021Quote: ... 1×106 (24-well plate) or 5×105 (48-well plate) CD8+ T cells were activated with Dynabeads Mouse T-Activator CD3/CD28 (Thermo Fisher, 11456D) in a 1:1 bead to T cell ratio and cultured in 2 ml (24-well plate ...
-
bioRxiv - Microbiology 2023Quote: ... Formalin-killed N61 in PBS was dried in an oven at 5×106 cells/well in 96-well ELISA plates (C96 Maxisorpcert, Nunc-Immuno Plate, Thermo Fisher Scientific) overnight at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... The brains were then washed in PBST-2 (PBS containing 0.1% Triton X-100) for 3 x 2 mins and blocked with SeaBlock blocking buffer (Thermo Fisher) for 15 mins at room temperature ...