Labshake search
Citations for Thermo Fisher :
851 - 900 of 10000+ citations for 2' 3' cGAMP STING based FRET Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... University of Birmingham) cells transfected with pcDNA5/FRT/TO based vectors (Supplemental table 2) and the recombinase pOG44 (Invitrogen) using FuGene6 (Promega ...
-
Direct analysis of ribosome targeting illuminates thousand-fold regulation of translation initiationbioRxiv - Molecular Biology 2020Quote: ... and 3′ biotinylated using the Pierce RNA 3′end biotinylation kit (Thermo Scientific 20160).
-
bioRxiv - Systems Biology 2019Quote: 3’-tRNAs biotinylation was adapted from Pierce RNA 3’-End Biotinylation Kit (Thermo Fisher). Deacylated tRNAs were denaturated in 25% DMSO at 85°C for 5 minutes and directly chilled on ice ...
-
bioRxiv - Cell Biology 2020Quote: ... sonicated 3 three times for 5 sec each and analysed for protein content using the BCA protein assay kit (Thermo Fisher scientific). Samples containing 30 μl (1 μg/μl ...
-
bioRxiv - Genetics 2021Quote: ... the extracted DNA was directly Sanger sequenced from in 5’ and 3’ directions for each sample with the BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) according to the manufacturer’s protocol with the same primers as for the amplification (Prdm9ZnFA_Bal_R/Prdm9ZnFA_Bal_F) ...
-
bioRxiv - Microbiology 2019Quote: ... and antisense primer 3Vif (5-AGCTAGTGTCCATTCATTG-3) using a Superscript III single RT-PCR system with Platinum Taq DNA polymerase kit (Thermo Fisher Scientific) as per the manufacturers instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... and Heparin scaffold conditioned media groups (n=5) across 21 days (Days 0, 3, 7, 14, 21) using a RNAqueous™-Micro Total RNA Isolation Kit (ThermoFisher Scientific). RNA was then reverse transcribed to cDNA using a QuantiTect Reverse Transcription Kit (Qiagen ...
-
bioRxiv - Biochemistry 2020Quote: ... Sequencing primer 5’-AAGCTGGAGCTCCACCGCGG-3’ was annealed and sequencing was performed with the USB Sequenase Version 2.0 DNA sequencing kit (Thermo Fisher Scientific - 70770).
-
bioRxiv - Developmental Biology 2019Quote: ... Ovaries were then washed twice for 5 minutes each with 1XPBS + 3% BSA and then carried through the Click-iT Plus EdU Imaging Kit protocol (Thermo Fisher Scientific). Ovaries were imaged on a Nikon A1R-SI+ confocal microscope and >50 stage 10 chambers were examined for EdU foci in each genotype.
-
bioRxiv - Bioengineering 2020Quote: The IGFBP-derived NLS peptides (NLS-3 and NLS-5) were extracted from the bacteria using the B-Per 6xHis Fusion Protein Purification Kit (Thermo Scientific, USA), according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... RT-PCR was performed using OC43-nucleocapsid specific TaqMan primers and a probe 18 fluorescent- labelled with a 5’-FAM reporter dye and 3’-BHQ quencher (IDT) and AgPath-ID™ One-Step RT-PCR kit (AgPath AM1005, Applied Biosystems) on an ABI QuantStudio 3 platform (Thermo Fisher) ...
-
bioRxiv - Physiology 2020Quote: ... as well as non-specific negative control oligonucleotides (5′-AAATGTACTGCGCGTGGAGAC-3′) were cloned into pcDNA6.2-GW/EmGFP-miR [“BLOCK-iT™ PolII miR RNAi Expression Vector Kit” (Invitrogen, Darmstadt, DEU). Human Flag- and myc-tagged GPT and GPT2 cDNA was obtained from Origene (RC203756 and RC209119) ...
-
bioRxiv - Microbiology 2022Quote: ... 5’-/FAM/TCAAGGAACAACATTGCCAA/TAMRA/-3’) were examined by real-time RT-PCR using High Capacity cDNA Reverse Transcription kit (Applied Biosystems, 4368813) and AriaMX (Agilent ...
-
bioRxiv - Developmental Biology 2023Quote: ... R: 5′- AAAGCACCGACTCGGTGCCAC-3′) and used as a template for in vitro transcription using MEGAshortscript T7 kit (Ambion/Thermo Fisher Scientific AM1354). 2ng gRNA was injected together with 1.9nM Cas9 protein (New England Biolabs M0386T ...
-
bioRxiv - Developmental Biology 2023Quote: ... R: 5′- AAAGCACCGACTCGGTGCCAC-3′) and used as a template for in vitro transcription using MEGAshortscript T7 kit (Ambion/Thermo Fisher Scientific AM1354). 2ng gRNA was injected together with 1.9nM Cas9 protein (New England Biolabs M0386T ...
-
bioRxiv - Microbiology 2024Quote: ... and 1492R (5’-TACGGYTACCTTGTTACGACTT-3’) [29–31] with the Invitrogen Platinum II Taq Hot-Start DNA Polymerase kit (Cat. No. 14966001, Invitrogen, Waltham, MA). The 16S rRNA gene amplicons were sequenced by GENEWIZ (Azenta Life Sciences ...
-
bioRxiv - Microbiology 2020Quote: ... RNA (∼3 µg) was treated with 2 units turbo-DNase (Invitrogen) in 1X turbo-DNase buffer for 30 min at 37 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... with half media changes every 2-3 days with Neurobasal (ThermoFisher #21103049 supplemented with Primocin (InvivoGen #ant-pm-1) ...
-
bioRxiv - Neuroscience 2020Quote: ... Neurons are washed 2-3 times with Neurobasal-A medium (Gibco) prior to fixation.
-
bioRxiv - Cell Biology 2021Quote: Cells were loaded with 3 μM Fura-2 AM (Invitrogen/ThermoFisher) (Kd at RT = 225 nM ...
-
bioRxiv - Cell Biology 2021Quote: Cells were loaded with 3 μM Fura-2 AM (Invitrogen/ThermoFisher) (Kd at RT = 225 nM ...
-
bioRxiv - Cell Biology 2021Quote: ... from 2-3 µg of RNA using oligo(dT) (Invitrogen 18418012) as primer ...
-
bioRxiv - Biochemistry 2021Quote: ... the cells were washed 3 times with 2 mL DPBS (Gibco), scraped and lysed in 4% SDC buffer (4% sodium deoxycholate ...
-
bioRxiv - Bioengineering 2021Quote: ... and 3 µL of tris(2-carboxyethyl)phosphine (Thermo Fisher Scientific) to 30 µL of sample ...
-
bioRxiv - Genetics 2020Quote: ... in a proportion of 4:3:2 using Lipofectamine 2000 (ThermoFisher). HEK293T cells were maintained in DMEM complete medium (DMEM [Gibco] supplemented with 10% of FBS and 100 UI of Penicillin/Streptomycin) ...
-
bioRxiv - Biophysics 2022Quote: ... Cells were passaged every 2-3 days using Accutase (Thermo Fisher). For experiments about 5000 cells were seeded per dish ...
-
bioRxiv - Biophysics 2023Quote: ... 3 µL of 2% 0.2 µm carboxylated FluoSpheres (Invitrogen, Carlsbad, CA), 20 µL of 20 mM Lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP ...
-
bioRxiv - Immunology 2023Quote: ... MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide) (Thermo Fisher) assay was performed by incubating the cells with 50 µg/µl MTT (5 mg/ml stock ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were loaded with 3 µM of Fura-2 AM (Invitrogen) in extracellular solution (ECS ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
Inhibition of nucleotide synthesis promotes replicative senescence of human mammary epithelial cellsbioRxiv - Systems Biology 2019Quote: Metabolites were detected and quantified as area under the curve based on retention time and accurate mass (≤ 5 ppm) using the TraceFinder 3.3 (Thermo Scientific) software ...
-
bioRxiv - Systems Biology 2021Quote: Metabolites were detected and quantified as area under the curve based on retention time and accurate mass (≤ 5 ppm) using the TraceFinder 3.3 (Thermo Scientific) software ...
-
bioRxiv - Cancer Biology 2020Quote: ... 95% and 100% 2x) and in two changes of xylene 5 minutes each and finally mounted using xylene-based DPX mounting media (ThermoFisher). Slides were analysed using optical microscopy ...
-
bioRxiv - Cancer Biology 2020Quote: ... For the image-based flow cytometry analyses cells were incubated for 20 min in PBS with 5 μg/ml Hoechst33342 (ThermoFisher), prior to harvest ...
-
bioRxiv - Systems Biology 2019Quote: Metabolites were detected and quantified as area under the curve based on retention time and accurate mass (≤ 5 ppm) using the TraceFinder 3.3 (Thermo Scientific) software ...
-
bioRxiv - Cell Biology 2020Quote: ... Metabolites were detected and quantified as area under the curve based on retention time and accurate mass (≤ 5 ppm) using the TraceFinder 3.3 (Thermo Scientific) software.
-
bioRxiv - Immunology 2022Quote: ... at 37°C and 5% CO2 for 2 h in 12-well Nunclon™ Delta surface-treated flat bottom plates (Thermo Fisher Scientific, Waltham, MA). Non-adherent cells were removed by gently washing the cells with pre-warmed culture medium ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples (5 μl aliquot) were normalized to 2-5 nM with Nuclease-free Water (Ambion), then 2 μl from each sample within one 96-index set was pooled to a total of 192 μl at 2-5 nM concentration ...
-
bioRxiv - Immunology 2020Quote: ... 5’/VIC/CCTTGGGTTCTTGGGA/3’/MGB (Thermo Fisher Scientific; (Bruner et al., 2016)) ...
-
bioRxiv - Immunology 2020Quote: ... 5’/NED/AAGCCAGGAATGGATGGCC/3’/MGB (Thermo Fisher Scientific; (Schmid et al., 2010)).
-
bioRxiv - Genetics 2019Quote: ... 5’-6FAM-CTC AGA CCA GCT GAA G-MGB-3’ (Life Technologies). DENV-1 KDH0026A ...
-
bioRxiv - Microbiology 2021Quote: ... Sections were cut at 3-5 μm on a cryotome (ThermoFisher Scientific) using C35 carbon steel blades (Feather ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 5 μl Turbo DNase buffer and 3 μl Turbo DNase (ThermoFisher Scientific) were added to each reaction and incubated for 30 min at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell pellet was suspended in 3-5 ml TrypLE Express (ThermoFisher, 12605028) depending on the pellet volume and incubated at 37°C for 10-15 min with mixing every 5 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 10% (for RS-5) or 20% (for DM-3) FBS (Gibco). All the other cells were cultured in RPMI medium (Gibco ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were passaged every 3-5 days using Trypsin-EDTA (Gibco, 25200056). All experiments were done with cells at 10 passages or earlier with regular testing for mycoplasma ...
-
bioRxiv - Cell Biology 2020Quote: ... 5′-ATTTGTCGACTCATTCTAATCCTTCGTCTTTTGATT-3′ by using Phusion high-fidelity DNA polymerase (Thermo Scientific) and cDNA prepared from the parasites as template ...
-
bioRxiv - Cell Biology 2020Quote: ... were transfected with human myosin VI siRNA duplex (5′GGUUUAGGUGUUAAUGAAGtt-3′) (Ambion) or AllStars Negative Control siRNA duplex (Qiagen ...
-
bioRxiv - Biophysics 2021Quote: ... LUVs were prepared using sonication (Fisher Scientific, Ultrasonic Bath, 3 × 5 min). Sonication was performed in ice water bath ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl Turbo DNase buffer and 3 μl Turbo DNase (ThermoFisher Scientific) were added to each sample and incubated for 30 min at 37°C ...