Labshake search
Citations for Thermo Fisher :
751 - 800 of 10000+ citations for 2' 3' cGAMP STING based FRET Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... a DNA oligo template (5’ TAATACGACTCACTATAGGGACACAAAACAAAAGACAAAAACACAAAACAAAAGACAAAAACA CAAAACAAAAGACAAAAAGCCTCTCCTTCTCTCTGCTTCTCTCTCGCTGTGTGCGTACAACTAGCT 3’) was PCR-amplified and then in vitro transcribed using the MEGAshortscript™ T7 Transcription kit (Invitrogen). An 11:7 ratio of the helicase RNA substrate to 5’ Alex Fluor 488 fluorescent oligo strand (Alexa Fluor 488/ AGCTAGTTGTACGCACAC ...
-
bioRxiv - Bioengineering 2022Quote: Primary neonatal cardiomyocytes were isolated from C57BL/6 mouse neonates on postnatal days 3-5 using the Pierce Primary Cardiomyocyte Isolation Kit (Thermo Fisher) as previously described (14) ...
-
bioRxiv - Plant Biology 2020Quote: ... Rapid amplification of the 5’ and 3’ cDNA ends (RACE) was subsequently carried out by using the First Choice RLM-RACE kit from Ambion (USA), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... Six μg of the isolated RNA was used for 5’- and 3’ RACE reactions with a FirstChoiceTM RLM-RACE Kit (ThermoFisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... These RNAs were 35 nucleotides long and they were prepared by in vitro transcription using a DNA template (5’-CAGTAATACGACTCACTATAGGGGAAGCGGGCATGCGGCCAGCCATAGCCGATCA-3’) and the TranscriptAid T7 high-yield transcription kit (Thermo Scientific). The reaction was performed in a 50-μl mixture containing 1× TranscriptAid reaction buffer ...
-
bioRxiv - Developmental Biology 2023Quote: ... and sequenced with the M13 forward primer (5’-GTAAAACGACGGCCAG-3’) using a BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GGAGCCATGGCCGCGTCCGG-3’ and 5’-GGACGGGCGGTCGGTCTGAG-3’ were chosen as Cas9 targeted guide RNAs (sgRNAs) and in vitro transcribed using the MEGAshortscript Kit (ThermoFisher, USA) and subsequently purified using MEGAclearTM Kit ...
-
bioRxiv - Molecular Biology 2023Quote: The RNA of 500 µL iRBCs at 3-5% parasitaemia was isolated using 3 mL TRIzol reagent (Invitrogen) followed by phenol-chloroform phase separation ...
-
bioRxiv - Microbiology 2023Quote: ... Metabolites were detected and quantified as area under the curve based on retention time and accurate mass (5 ppm) using the TraceFinder 4.1 software (ThermoFisher).
-
bioRxiv - Immunology 2021Quote: ... Magnetic bead based 26-plex cytokine kits were purchased from Invitrogen (Catalog # EPXR260-26088-901). These Luminex multiplex assay plates were read using the FlexMap3D instrument ...
-
bioRxiv - Cancer Biology 2020Quote: Cellular proliferation was measured using the fluorescence-based proliferation CyQuant NF kit (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... bead-based multiplex kit for Non-Human Primate Cytokines (Cat # EPX370-40045-901, ThermoFisher Scientific) was used according to manufacturer instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... T7-based linear amplification of the mRNA was performed using the megascript kit from Ambion. Hybridisation was performed on the Affymetrix GeneChip platform and processed according to standard procedure 75.
-
bioRxiv - Immunology 2021Quote: ... and quantification was based on the Qubit DNA HS Assay Kit (Thermo Fisher Scientific, USA). Final libraries were pooled and sequenced using a High output single-end 75 cycle (version 2 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... pLL3.7m-based plasmids were purified by PureLink Expi Endotoxin-free Maxi plasmid Purification kit (Invitrogen), and then HEK293T (ATCC ...
-
bioRxiv - Cell Biology 2023Quote: ... high-throughput methodology based on the MagMAX Cell-Free DNA Isolation Kit (Thermo Fisher Scientific) that has been previously described(129) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the cell layers are examined for cell morphology using a phase contrast microscope washed with media and then 10 uM of 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in the presence or absence of 100 nM insulin as the initiating step and incubated for 20 or 30 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... pH 7.0) and 2 µg anti-5-methylcytosine (5-mC) antibody (Thermo Fisher, 33D3), and incubated at 4°C overnight with rotation ...
-
bioRxiv - Immunology 2020Quote: ... Immulon 2 plates were coated with 500 ng streptavidin (Invitrogen) for 2 hours at 37°C ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... White MicroLite™ 2+ 96-well plates (Thermo Scientific, #7572) were similarly coated with His-tagged GT198 proteins and blocked with BSA as above ...
-
bioRxiv - Molecular Biology 2019Quote: ... or 2 mm (for 96-well plates from Thermo Scientific), orbital shaking at 200 rpm ...
-
bioRxiv - Neuroscience 2023Quote: ... coated plate with a Neurobasal medium containing 2% B27 (ThermoFisher) (63).
-
bioRxiv - Plant Biology 2021Quote: ... Expression vectors containing the promoter-gene-fluorescent tag cassette or 3’UTR were obtained by using LR clonase-based three-fragment recombination system (Invitrogen®), the pB7m34GW/pH7m34GW/pK7m34GW/pS7m43GW/ pLOK180_pR7m34g (gift from L ...
-
bioRxiv - Microbiology 2023Quote: ... The INT-based rate is converted to O2 consumption using 3 unique 12-point dilution-based standard curves of freshly prepared Fomazan dye (Fisher Scientific). To compare the O2 drawdown method to the INT methods ...
-
bioRxiv - Cancer Biology 2023Quote: ... Relative quantitation of mRNAs was carried out via SYBR green-based quantitative PCR using a Quantstudio 3 Real-time PCR system (Applied Biosystems). PCR results were analyzed using the 2-(ΔΔCT ...
-
bioRxiv - Cell Biology 2024Quote: ... The frequency change for each cell was converted to buoyant mass of the cell based on calibration using NIST-certified polystyrene beads (3 µm and 10 µm in diameter, Duke Standards, Thermo Scientific). For Coulter counter data analysis ...
-
bioRxiv - Neuroscience 2019Quote: ... The inter-molecular tau FRET biosensor was generated by transiently transfecting HEK293 cells using Lipofectamine 3000 (Invitrogen) with tau-GFP and tau-RFP (1:20 DNA plasmid concentration ratio) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were laden with a fluorescence resonance energy transfer (FRET) substrate CCF4-AM (ThermoFisher Scientific, Invitrogen™), which can be proteolytically cleaved by Blam ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were laden with a fluorescence resonance energy transfer (FRET) substrate CCF4-AM (ThermoFisher Scientific, Invitrogen™), which can be proteolytically cleaved by Blam ...
-
bioRxiv - Microbiology 2022Quote: ... The F gene was PCR amplified using primers RSV F 5’ (5’GCAAGGATTCCTTCGTGAC3’) and RSV F 3’ (5’CACACCACGCCAGTAG3’) and Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific). Sanger sequencing was performed by Elim Biosciences.
-
bioRxiv - Microbiology 2022Quote: HK1 grown in 100 mm plates were transfected with 5 μg of RFP-LMP1 or GFP-PD-L1 plasmid using Lipofectamine 3000 transfection kit (Invitrogen, L3000015). Lipofectamine reagents were diluted in Opti-MEM medium (Gibco ...
-
bioRxiv - Immunology 2021Quote: ... Plates were blocked with 5% Fetal Bovine Serum (FBS; Life Technologies) in PBS ...
-
Hepatic FGF21 mediates tissue tolerance during bacterial inflammation by preserving cardiac functionbioRxiv - Immunology 2020Quote: ... plated on Blood Agar (TSA with 5% Sheep Blood) plates (ThermoFisher), and incubated at 37°C for 18 hours.
-
bioRxiv - Microbiology 2023Quote: ... with 5% FBS in NUNC 24-well plates (Thermo Fisher Scientific). Prior to inoculation of cells ...
-
bioRxiv - Microbiology 2024Quote: ... Columbia agar plates with 5% sheep blood (Thermo Fisher Scientific, PB5039A) were streaked with the corresponding glycerol stocks ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 3×(CAC)2 and (CAC)2 RNAs were transcribed using T7 RNA polymerase (Thermofisher Scientific). A 10 μl binding reaction contains 10 nM RNA ...
-
bioRxiv - Developmental Biology 2021Quote: ... EdU detection was conducted using a Click-iT EdU imaging kit (Invitrogen) according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2019Quote: ... Detection of EdU was performed used Click-iT EdU imaging Kits (Invitrogen for green signal and Base Click for red signal).
-
bioRxiv - Neuroscience 2019Quote: ... and blots were detected using an ECL detection kit (Invitrogen, Waltham, MA).
-
bioRxiv - Genetics 2019Quote: ... Blots were developed using the Pierce ECL Plus detection kit (Thermo Scientific).
-
bioRxiv - Cancer Biology 2020Quote: ... Then the proteins were visualized using an ECL detection kit (Thermo Scientific).
-
bioRxiv - Genomics 2019Quote: ... Visualization was performed using the Chemiluminescent Nucleic Acid Detection Module Kit (ThermoFisher), following manufacturer instructions for blocking ...
-
bioRxiv - Microbiology 2022Quote: ... Bound probe was detected using the BrightStar Northern Blot detection kit (Invitrogen). Because probes could not be stripped from membranes ...
-
bioRxiv - Cell Biology 2022Quote: ... Apoptotic cells were detected using the Annexin V Apoptosis Detection Kit (Invitrogen). Cells were grown and harvested as detailed ...
-
bioRxiv - Microbiology 2019Quote: ... bound probe was detected using the BrightStar Northern Blot detection kit (Invitrogen, Fisher Scientific UK Ltd ...
-
bioRxiv - Microbiology 2020Quote: ... Thiol content was then measured using the Thiol Fluorescent Detection Kit (Invitrogen), according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2020Quote: ... Bands were visualized using the Chemiluminescent Western Blot Detection Kit (Thermo Fisher).
-
bioRxiv - Cell Biology 2021Quote: ... HRP was detected by Pierce SuperSignal detection kit (Thermo-Fisher Scientific, #A45916) and the chemiluminescence signal was captured with a ChemiDoc MP Imaging System (BioRad) ...
-
bioRxiv - Neuroscience 2022Quote: ... Each band was detected using chemiluminescence detection kit (32106; Thermo Fisher Scientific) and data was analyzed using image J software to measure relative protein expression.
-
bioRxiv - Neuroscience 2023Quote: ... before ECL detection with the Supersignal West Femto Kit (Thermo Fisher, #34095) and imaged on the Biorad Gel Imaging system (Chemidoc ...