Labshake search
Citations for Thermo Fisher :
651 - 700 of 10000+ citations for 2' 3' cGAMP STING based FRET Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... from RNA extracted from freshly isolated peripheral blood mononuclear cells (PBMCs) utilizing the following primers: forward 5’-GAGAATTCACCATGACTATGGAGACCCAAATG-3’ and reverse 5’-CGTACGCCCCATTGGTGAAGAGCTGCC-3’ (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was fused in tandem by restriction enzyme-compatible ends with the CD8α transmembrane domain and the CD28 and CD3ζ intracellular regions already available in the lab (CD32131R-CR) ...
-
bioRxiv - Biochemistry 2023Quote: ... cyriacigeorgica clinical isolate responsible for pulmonary nocardiosis was used as a template for polymerase chain reaction (PCR) with primers 5’- gatatgcaccacggcctgca-3’ and 5’-acggcgacgaagaagcgga-3’ by using Invitrogen™ Platinum SuperFi II DNA Polymerase (Thermo Fisher Scientific, Illkirch, France). A second PCR was performed on the aforementioned amplicon to amplify the truncated version of NCY-1 with the following forward 5’-ggtaccgagaacctgtacttccagggttcggccgtggccgatccccggttcgccgcactggaaacg-3’and reverse 5’- gtggtgctcgagctaaccgagcacgtcgacgaccgtcctggtcgcgtcggc-3’primers ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Hybridization and detection of biotinylated probes was performed using the North2South™ Chemiluminescent Hybridization and Detection Kit (Thermo Fisher Scientific) following manufacturer instructions.
-
bioRxiv - Molecular Biology 2020Quote: ... Protein bands were then detected with an enhanced chemiluminescence (ECL) detection kit and an ECL detection instrument (Thermo Fisher Scientific). Image Lab 4.0.1 was used to analyze these results ...
-
bioRxiv - Neuroscience 2024Quote: ... membranes were washed after secondary antibody incubation before protein detection using SuperSignal West Pico Chemiluminescence Detection kit (Thermo Fisher Scientific). Images were acquired with a Bio-Rad Chemidoc XRS+ gel imaging system and analyzed with ImageJ/Fiji software (National Institutes of Health) ...
-
bioRxiv - Bioengineering 2022Quote: ... Slides were dehydrated by sequential submersion in 100% ethanol (2× 5 min) and SafeClear II (2× 5 min, Fisher Scientific) before being mounted in Cytoseal 60 (ThermoFisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 52h after plating 5 µM 5-ethynyl-2′-deoxyuridine (EdU, Life Technologies) was added for 20 h ...
-
bioRxiv - Biochemistry 2020Quote: FRET bursts measurements were performed in a chambered coverglass well (155411, Nunc Lab-Tek, Thermo Scientific). The reaction volume was 200 μl ...
-
bioRxiv - Biochemistry 2020Quote: FRET bursts measurements were performed in a chambered coverglass well (155411, Nunc Lab-Tek, Thermo Scientific). The reaction volume was 200 μl ...
-
bioRxiv - Cell Biology 2020Quote: Annexin V Apoptosis Detection Kit APC (cat# 88-8007-72, ThermoFisher)
-
bioRxiv - Microbiology 2021Quote: ... washed and developed using a LightShift chemiluminescent detection kit (Thermo Scientific). EMSA supershift assays were performed similarly ...
-
bioRxiv - Cancer Biology 2019Quote: ... Leica’s Bond Polymer Refine Red detection kit (DS9390) and DAPI (Invitrogen, Carlsbad ...
-
bioRxiv - Biochemistry 2020Quote: ... Signals were detected by using the ECL plus detection kit (ThermoFisher).
-
bioRxiv - Biochemistry 2020Quote: ... Signals were detected by using the ECL plus detection kit (ThermoFisher).
-
bioRxiv - Neuroscience 2020Quote: ... Blots were developed with a chemiluminescence detection kit (Thermo Fisher Scientific) and images were acquired with Fusion SL (Vilber) ...
-
bioRxiv - Immunology 2021Quote: ... cells were stained using the Annexin V apoptosis detection kit (ThermoFisher) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Detection was performed by the DAB substrate kit (Thermo Scientific, USA).
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentration was measured with the BCA protein detection kit (ThermoFisher). Proteins were separated on a 4-12% BisTris polyacrylamide gel (Novex by Life Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... Signals were detected using the supersignal West pico detection kit (Thermofisher) and images were acquired and quantified with a Licor Odyssey FC imaging system.
-
bioRxiv - Immunology 2022Quote: ... For apoptosis the Annexin V Apoptosis Detection Kit eFluor 450 (Invitrogen) was used ...
-
bioRxiv - Physiology 2019Quote: ... immunoreactivity was detected using chemiluminescence detection kit reagents (Thermo Scientific, USA) and a Chimidoc™ Station (Bio-Rad).
-
bioRxiv - Microbiology 2019Quote: ... Protein detection was performed by chemiluminescence using an ECL kit (ThermoFisher) with the ChemiDoc XRS+ Imaging System (Bio-Rad).
-
bioRxiv - Biochemistry 2020Quote: ... Signals were detected by using the ECL plus detection kit (ThermoFisher).
-
bioRxiv - Pathology 2021Quote: ... Protein bands were visualized using a chemiluminescent detection kit (Thermo Scientific) coupled with a camera-based imaging system (Biospectrum AC ImagingSystem) ...
-
bioRxiv - Microbiology 2020Quote: ... Slides were stained using the Pierce Peroxidase Detection Kit (Thermo Scientific). The primary antibody was the pan-flavivirus clone D1-4G2-4-15 ...
-
bioRxiv - Genomics 2020Quote: ... The North2South® Chemiluminescent Hybridization and Detection Kit (Thermo Fisher: 17097) was used to detect the biotin signal with the help of a CCD camera ...
-
bioRxiv - Immunology 2020Quote: ... efficiency was evaluated with GeneArt Genomic Cleavage Detection Kit (Invitrogen™) according to the manufacturer instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Blots were developed with a Pierce ECL detection kit (Thermo Fisher).
-
bioRxiv - Neuroscience 2022Quote: ... using the enhanced chemiluminescence (ECL) Plus detection kit (Thermo Fisher Scientific).
-
bioRxiv - Cancer Biology 2022Quote: ... an Annexin V-FITC Apoptosis Detection Kit (Thermo Fisher Scientific, RRID:AB_2575600) was used ...
-
bioRxiv - Neuroscience 2023Quote: ... and developed the blots with the ECL Ultra detection kit (ThermoFisher). For unprocessed gel images ...
-
bioRxiv - Microbiology 2023Quote: ... ROS detection kits (88-5930-74) were bought from Thermo Fisher Scientific-CN ...
-
bioRxiv - Genetics 2023Quote: ... using the Annexin V Apoptosis Detection Kit (ThermoFisher, 88-8007-72). Analysis was done using a BD LSR II Flow Cytometer.
-
bioRxiv - Neuroscience 2023Quote: ... EdU detection using the Alexa Fluor 555 Click-iT kit (Invitrogen) was performed prior to blocking ...
-
bioRxiv - Cell Biology 2023Quote: ... Chemiluminescent detection was performed using the SuperSignal kit (Thermo Fisher Scientific) and quantified using a ChemiDoc MP imaging system with Image Lab 6.1 software (Bio-Rad).
-
bioRxiv - Molecular Biology 2023Quote: ... Blots were visualized with Supersignal West Femto detection kit (Thermo Fisher) using a LI-COR Odyssey imager ...
-
bioRxiv - Plant Biology 2023Quote: ... The signal was detected using the ECL detection kit (Thermo Scientific). Band intensities were quantified using the Fiji (ImageJ ...
-
bioRxiv - Developmental Biology 2023Quote: ... Metabolites were quantified as area under the curve based on retention times and using accurate mass measurements (≤ 3 ppm) with the TraceFinder 3.1 software (Thermo Scientific). For heatmap depiction ...
-
bioRxiv - Microbiology 2019Quote: ... Amplification and detection of targeted genes was performed with the QuantStudio™ 5 (Applied Biosystems) with the following cycling conditions ...
-
bioRxiv - Microbiology 2019Quote: ... Amplification and detection of targeted genes was performed with the QuantStudio™ 5 (Applied Biosystems) with the following cycling conditions ...
-
bioRxiv - Microbiology 2022Quote: ... agar plates supplemented with 3% v/v defibrinated horse blood (Thermo Scientific) and subsequently grown in BHI broth at 37°C to OD600nm=0.3 ...
-
bioRxiv - Microbiology 2024Quote: ... Plates were run on QuantStudio 3 Real-Time PCR system (Thermo Fisher). Cycle conditions were as follows ...
-
bioRxiv - Cancer Biology 2021Quote: ... EdU 10μM (5-ethynyl-2’-deoxyuridine, ThermoFisher Scientific) diluted in fresh medium was added in the well for 10 minutes (MIA PaCa-2) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... loaded with 5 μM Rhod-2,am (ThermoFisher) in a zinc-containing HEPES-based salt solution (HBSS ...
-
bioRxiv - Molecular Biology 2021Quote: ... EdU (5-ethynyl-2’-deoxyuridine, Invitrogen, cat# A10044) was dissolved in PBS at 0.5 µg/µl and injected intraperitoneally into mice at 5 µg/g body weight 24 h before harvesting ...
-
bioRxiv - Developmental Biology 2019Quote: ... 5-ethynyl-2’deoxyuridine (EdU; Thermo Fisher Scientific) or 5-Bromo-2’deoxyuridine (BrdU ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5-ethynyl-2’– deoxyuridine (27) (Invitrogen, Cat# A10044) was administered through drinking water (0.5mg/ml) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3μM EdU (5-ethynyl-2′-deoxyuridine, A10044 Invitrogen) was added to the culture for 48h in the following time window ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 mL N-2 Supplement (Thermo Fisher 17502048). Long-Term Glioma Organoid Medium and Short-Term Glioma Organoid Medium stocks were used up to 2 months and 1 week after preparation ...
-
bioRxiv - Bioengineering 2022Quote: ... 5-norbornene-2-carboxylic acid (99%, Fisher Scientific) (12:1 to HA-TBA repeat unit) ...