Labshake search
Citations for Thermo Fisher :
8651 - 8700 of 10000+ citations for 7 Chloromethyl 2 2 dimethyl 2 3 dihydro 1 benzofuran since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... and mounted with the hybridization buffer (10% Dextran sulfate Sigma D8906, 30% Formamide, 1 mg/ml E.coli tRNA Sigma R1753, 2× SSC, 0.02% BSA Ambion AM2616 ...
-
bioRxiv - Molecular Biology 2020Quote: ... LIVE/DEAD discrimination was performed by staining with 1 µg/ml of 4’6-diamidino-2-phenylindole (DAPI, Invitrogen).
-
bioRxiv - Neuroscience 2021Quote: ... From D4 on N2/B27 (Neurobasal mediumTM/GLUTAMAX/ 2% B27 w/o vitamine A [Gibco]/ 1% N2 [Gibco]) was added to the KSR medium every second day in increments of 25% ...
-
bioRxiv - Neuroscience 2021Quote: ... From D4 on N2/B27 (Neurobasal mediumTM/GLUTAMAX/ 2% B27 w/o vitamine A [Gibco]/ 1% N2 [Gibco]) was added to the KSR medium every second day in increments of 25% ...
-
bioRxiv - Neuroscience 2021Quote: ... 100μl of 2% milk prepared in 0.1% PBST containing 1:1000 concentration of mouse αGFP antibody (Life Technologies #A-11120 ...
-
bioRxiv - Neuroscience 2021Quote: ... human DRGs immediately were cut into 1-2 mm pieces and stored in RNA-later (ThermoFisher, Cat# AM7021). For ISH ...
-
bioRxiv - Microbiology 2020Quote: ... Parasite nuclei were visualized by incubating samples with 1-2 μg/ml Hoechst 33342 (Thermo Scientific Pierce 62249) for 10-20 minutes at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... coverslips were incubated for 2 hours in secondary antibody [Goat-anti-rabbit (1:3000; Alexafluor 568, Invitrogen, ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... 1 ml of the seed virus was treated with 2 μl TURBO DNase (Thermo Fisher Scientific, cat# AM2238) and incubated at 37°C for 1 h ...
-
bioRxiv - Neuroscience 2022Quote: ... iPSCs were transfected with PB-TO-hNIL vector in a 1:2 ratio (transposase:vector) using Lipofectamine Stem (Invitrogen), then selected after 24-48 hours for 3 to 14 days with 8 µg/mL of puromycin (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... secondary antibody (AlexaFluor488 donkey anti mouse IgM 1/400, Life Technologies in Buffer A, 0.1% Saponin 2% FCS) was performed ...
-
bioRxiv - Plant Biology 2020Quote: ... Total proteins were extracted from infiltrated leaf patches in 1 ml 2×NuPAGE LDS sample buffer (Invitrogen, NP0008) containing 0.05mL/mL β-mercaptoethanol ...
-
bioRxiv - Physiology 2021Quote: ... Complementary DNA was synthesized from 1 to 2 μg of RNA using SuperScript VILO Master Mix (Life Technologies). Quantitative real-time polymerase chain reaction (qRT-PCR ...
-
bioRxiv - Microbiology 2021Quote: ... replicon transfected PS cells were maintained medium supplemented with in a 2% FBS and 1% Penicillin-Streptomycin (Invitrogen). Sf9 cells (ATCC ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and 6 μg of pcDNA-SARS-CoV-2-S(ΔC19) in 1 ml of Opti-MEM medium (ThermoFisher). Then ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then stained with 1 μg/mL 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes/Thermo Fisher) and analysed on a FACSVERSE (BD Biosciences) ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then stained with 1 μg/mL 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes/Thermo Fisher) and analysed on a FACSVERSE (BD Biosciences) ...
-
bioRxiv - Immunology 2020Quote: ... 1-2 µg total RNA was reverse transcribed using SuperScript IV VILO Master Mix with ezDNase Enzyme (Invitrogen) into cDNA ...
-
bioRxiv - Cell Biology 2021Quote: ... Coverslips were rinsed 2 x in DI water before mounting onto 1 mm-thick glass slides (Thermo Scientific) using anti-fade mounting medium (Dako).
-
bioRxiv - Cell Biology 2021Quote: ... 1:1000) for 2 hrs and then washed 3X in PBS before mounting with Prolong Diamond (Life Technologies).
-
bioRxiv - Physiology 2020Quote: ... DAPI (4’,6-Diamidino-2-Phenylindole Dihydrochloride; 1:2000 diluted in PBTD; Thermo Fisher Scientific, Stockholm, Sweden; 62248) was added for 3 minutes followed by washing in PBTD for 25 minutes and mounting with ProLong gold antifade reagent (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: The scrambled siRNA or the specific VEGFR siRNA (VEGFR-1-VEGFR-2 siRNA, Ambion Life Technologies, Monza, Italy) were intrathecally (i.t. ...
-
bioRxiv - Neuroscience 2021Quote: The scrambled siRNA or the specific VEGFR siRNA (VEGFR-1-VEGFR-2 siRNA, Ambion Life Technologies, Monza, Italy) were intrathecally (i.t. ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were resuspended (2.25 x 107cells/1.5mL) in DMEM/F12 supplemented with 1% penicillin-streptomycin and 2% B27 (all from ThermoFisher) and transduced overnight with a TdTomato-lentivirus in a 2ml tube using an Intelli-Mixer RM-2L (Dutcher) ...
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by 2 hours of incubation in blocking solution containing anti-chicken Alexafluor488 (1:400; Life Technologies A11039) and anti-goat Alexafluor594 (1:1000 ...
-
bioRxiv - Neuroscience 2021Quote: ... then split for 1) propagation and 2) screening by Sanger sequencing using a 3730xl DNA Analyzer (Applied Biosystems). Colonies positive for the target edit and without other changes in the immediate vicinity (within 300-400 bp ...
-
bioRxiv - Neuroscience 2021Quote: ... slices were counterstained with 4’,6-diamidine-2’-phenylindole 502 dihydrochloride (DAPI, D3571, Molecular Probes; dilution 1:1000) for 5 minutes followed by 2 minutes wash in PBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... and diluted to 1-2 million cells/mL using a Countess™ Automated cell counter (Invitrogen; Carlsbad, CA). On each day of experiments ...
-
bioRxiv - Immunology 2020Quote: ... Anti-SARS-CoV-2 Coronavirus Spike protein (subunit 1) polyclonal antibody was purchased from Invitrogen (Carlsbad, CA, USA). Anti-SARS-CoV-2 Spike RBD rabbit polyclonal antibody was purchased from SinoBiological (Beijing ...
-
bioRxiv - Microbiology 2021Quote: ... and anti-SARS-CoV-2 spike protein (RBD) polyclonal antibody (RBD, 1:1,000, Invitrogen cat. no. PA5-114451). All primary antibodies were diluted in PBST + 5% milk and applied to membranes for ≥16 hours at 4 °C ...
-
bioRxiv - Immunology 2021Quote: ... Treated serum was then serially diluted 1 in 2 with PBS in 96 well v-bottom plates (Nunc) in 50 μL volumes ...
-
bioRxiv - Immunology 2020Quote: ... and lymphocytes were resuspended in complete RPMI (cRPMI- RPMI + 10% FCS + 2% Penicillin-Streptomycin + 1% L-glutamine (Gibco)) ...
-
bioRxiv - Neuroscience 2022Quote: ... or Alexa 647-labeled species-specific secondary antibodies for 2 hr at a dilution of 1:200 (Invitrogen; Jackson ImmunoResearch ...
-
bioRxiv - Immunology 2022Quote: ... incubating for 2 hrs at ambient temperature with Alexa Fluor donkey anti-Rabbit 555 1:200 (A31572, Invitrogen), DAPI for 5 minutes and then cover slipping the tissue sections with Aqua-Poly mount (Polysciences) ...
-
bioRxiv - Microbiology 2023Quote: ... parasite nuclei were visualized by incubating samples with 1-2 μg/mL Hoechst 33342 (Thermo Scientific Pierce 62249) for 10-20 minutes at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... and counterstained with 4′,6-diamidin-2-phenylindole (DAPI, 4 μg mL-1, Thermo Fisher Scientific, MA, USA). From the 18 biofilms from each year ...
-
bioRxiv - Molecular Biology 2023Quote: ... were blocked for 2 hr at 4 °C in lysis buffer containing 1 mg/ml yeast tRNA (Ambion) and washed twice with 1 ml lysis buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... From D4 on N2/B27 (Neurobasal medium/GLUTAMAX/2% B27 w/o vitamin A [Gibco]/1% N2 [Gibco] was added to the KSR medium every second day in increments of 25% ...
-
bioRxiv - Cancer Biology 2023Quote: ... organoids were passaged every 1-2 weeks by incubating organoids for 5-10 min in TrypLE Express (Gibco) at 37℃ and mechanical disruption to make organoids fall apart ...
-
bioRxiv - Developmental Biology 2023Quote: ... Bones were flushed using a 26-gauge needle of a 1-ml syringe with HBSS+2% FCS (Gibco). BM clumps were re-suspended by gentling aspirating with a 19-gauge needle ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated for 1 h in anti-HA 2-2.2.14 IgG1 mouse mAb (ThermoFisher Catalog# 26183; RRID:AB_10978021) diluted 1:2000 and following 3 x 10 min washes in 0.1 M PB ...
-
bioRxiv - Microbiology 2023Quote: ... with 100 µL cell suspension at the density of 2×105 cells mL-1 in Dulbecco’s modified Eagle’s medium (DMEM) (GIBCO) supplemented with 10% (v/v ...
-
bioRxiv - Physiology 2023Quote: ... containing 1% Triton X-100 and 2% Halt Protease and Phosphatase Inhibitor Cocktail (Thermo Scientific, Waltham, MA, USA). Lysates were sonicated and centrifuged ...
-
bioRxiv - Cell Biology 2023Quote: ... Nuclei were stained by incubation with 0.5 – 1 µg/mL 4’,6-diamidino-2-phenylindole (DAPI, D1306, Invitrogen) in PBS for 10 min at RT ...
-
bioRxiv - Physiology 2023Quote: ... sections were incubated 2 h at RT with A568 donkey anti-rabbit secondary antibody (1:500; Invitrogen; A10042) in [PB 0.2% Tx + 1% donkey serum] ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... sheared into pieces 1–2 kb in size and cloned using the TOPO Shotgun Subcloning Kit from Invitrogen. Colonies containing inserts were collected ...
-
bioRxiv - Immunology 2023Quote: ... BA.1 or BA.2 expression vectors (pcDNA3.1_ spike_del19) using Expifectamine Enhancer according to the manufacturer’s protocol (Thermo Fisher). Two days later ...
-
bioRxiv - Immunology 2023Quote: ... This step was followed by 2 hours incubation in Alexa Fluor anti-rabbit 488 (1:350, Life Technologies) and horse anti-mouse biotinylated (1:350 Life Technologies) ...
-
bioRxiv - Physiology 2022Quote: ... then incubated for 2 hours at room temperature in Alexa Fluor fluorescent secondary antibody (Life Technologies; 1:500) prepared in blocking solution ...