Labshake search
Citations for Thermo Fisher :
8551 - 8600 of 10000+ citations for 6H 1 3 Dioxolo 4 5 g 1 benzopyran 6 one 7 8 dihydro since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: For DNA plasmids: 5×106 HEK293T cells were grown in 6-well plates and Lipofectamine™ 3000 Transfection Reagent (L3000001, ThermoFisher UK) was used to transfect the cells following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: Exon 2 of A3A and exons 5 and 6 of A3B with either 20 or 80 bp of flanking intronic sequences were synthesized (Thermo Fisher Scientific) and cloned in sense orientation using XhoI and NotI restriction sites of Exontrap vector pET01 (MoBiTec ...
-
bioRxiv - Microbiology 2019Quote: ... isolated for each sediment-depth explored along SSK42/5 and 6 were shotgun sequenced individually on an Ion Proton sequencing platform (Thermo Fisher Scientific) using 200 nucleotide read-chemistry ...
-
bioRxiv - Biophysics 2019Quote: ... the final dye to protein ratio was typically 5-6 dye molecules per protein molecule as measured with a Nanodrop spectrophotometer (Thermo Fisher Scientific). Cells in suspension culture dishes were labeled with 0.5 nM fluorescent IgE for typically 12-20 hours before imaging.
-
bioRxiv - Molecular Biology 2019Quote: ... which consisted of 2.6 μl NFW, 5 μl TATAA SYBR Green mix (TATAA, Sweden) and 0.4 μl of 10 μM primers (Thermo Fisher Scientific, USA). Cycling protocol consisted of initial enzyme activation at 95°C (t = 3 min) ...
-
bioRxiv - Biochemistry 2021Quote: ... The mixture was left to equilibrate for 5 min at RT before 6 μL aliquots were placed in crystal-clear vials (Fisher Scientific UK) and snap-frozen in liquid nitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... was introduced into 5 × 106 C6/36 mosquito cells per well of a 6-well plate via Lipofectamine 2000 reagent (Thermo Fisher Scientific), following the product’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... The specificity of this antibody has been previously validated by us and others by Western Blot, IF and IHC analyses (5, 6).The Anti-NeuN mouse monoclonal antibody (ThermoFisher MA5-33103) was used for IF ...
-
bioRxiv - Zoology 2022Quote: ... or 5,6,11-trideoxyTTX (10−5 M) together with a dextran conjugated with Alexa Fluor 555 (M.W. 10,000, 10−6 M; D34679, Thermo Fisher Scientific, MA, USA) for 5 min ...
-
bioRxiv - Microbiology 2021Quote: ... 5 x 105 HCT116 cells were seeded in a 6 well plate with Dulbecco’s modified Eagle medium (DMEM, Gibco®, Life Technologies) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... The syn-gRNA oligos and syn-gRNA-NTC were transfected using Lipofectamine RNAiMAX transfection reagent (5 µl per 6-well; Thermo Fisher Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... C57BL/6 P4-5 mice pups were rapidly decapitated and brains were processed in Hibernate-A medium (Thermo Fisher Scientific, A12475-01). Resulting tissue was enzymatically disassociated in buffer containing HEPES-HBSS with DNase (Worthington Biochemical LS002007 ...
-
bioRxiv - Neuroscience 2022Quote: ... and 12 old (21 months) male C57BL/6 animals (combined over 2 independent experiments) were intraperitoneally injected with 5-ethynyl-2’- deoxyuridine (EdU) (Fisher Scientific, A10044) (resuspended in PBS at 5 mg/mL ...
-
bioRxiv - Developmental Biology 2022Quote: ... NC cells were aggregated into 3D spheroids (5 million cells/well) in Ultra Low Attachment 6-well culture plates (Fisher Scientific, 3471) and cultured in Neurobasal (NB ...
-
bioRxiv - Biophysics 2024Quote: Quantitative determination of intracellular pH (pHi) was performed using the cell-permeant ratiometric pH indicator SNARF™-5F 5-(and-6)-carboxylic acid AM (Thermo Fisher) in live imaged N2a cells at 48 hours of differentiation ...
-
bioRxiv - Cell Biology 2023Quote: ... coated 6-well plates at 5×105 cells/well in RPMI 1640 with B27 and 10% knockout serum replacement (Thermo Fisher Scientific). Cells were expanded by culturing in RPMI 1640 with B27 with 2 μM of CHIR99021 (Stemcell Technologies) ...
-
bioRxiv - Biophysics 2022Quote: ... EVs were stained with 5-(and-6)-Carboxyfluorescein diacetate succinimidyl ester (CFDA-SE, hereinafter referred as CFSE) (Thermo Fisher, Catalog No. C1157) and separated as described previously [10] ...
-
bioRxiv - Biochemistry 2023Quote: ... 6 μL was injected onto an Acclaim PepMap 100 column packed with 2 cm of 5 μm C18 material (Thermo Fisher, 164564) using 0.1% formic acid in water (solvent A) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 × 105 cells were seeded in 6-well plates and immediately transfected with a mixture of 10 μL Lipofectamine2000 (Thermo Fisher Scientific), 6 μL of 20 μM target-specific siRNA (or non-targeting siRNA as control) ...
-
bioRxiv - Cancer Biology 2023Quote: LN-229 cells were seeded at 2×10^5 cells/well into in 6-well Nunc™ Cell-Culture Treated Multidishes (ThermoFisher, #140675) and incubated overnight in reduced serum media at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... The nuclei of astrocytes and autaptic neurons were visualized by counterstaining with 4’,6-diamidino-2-phenylindole (DAPI)-containing mounting medium (ProLong® Gold Antifade Reagent with DAPI, Thermo Fisher Scientific). Only neurons with one nucleus were analyzed when counting synapse numbers.
-
bioRxiv - Microbiology 2022Quote: ... 0.1% Triton X-100 in PBS for 20 minutes, then were actin stained with DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride) nucleic acid stain (Thermo Fisher Scientific, USA) in PBS for 10 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... The cells were again washed and incubated for 10 min in a solution of 4’,6’-diamidino-2-phenylindole (DAPI) (Invitrogen, Thermo Fisher Scientific). Cells were imaged using a Leica DM IRB epifluorescence microscope ...
-
bioRxiv - Developmental Biology 2019Quote: ... After 4 days the embryoid bodies were transferred to 24 well or 6 well plates coated with collagen (Thermo Scientific®; A10483-01) containing Melanocyte conversion media (45% DMEM – High glucose ...
-
bioRxiv - Microbiology 2021Quote: ... Nuclei were counterstained with Hoechst 33342 DNA dye NucBlue® Live ReadyProbes® reagent for live cell imaging or 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI) and SYTO® 60 fluorescent nucleic acid stain for fixed samples (Invitrogen, Molecular Probes, Germany).
-
bioRxiv - Immunology 2020Quote: ... A viability dye was included in all Duraclone panels (Live/dead fixable dead cell stain kit from ThermoFisher Scientific or DAPI (4’,6-Diamidino-2-Phenylindole, Dilactate from ThermoFisher Scientific (Courtabœuf, France)) ...
-
bioRxiv - Microbiology 2020Quote: ... Alexa-Fluor 594 labelled goat anti-rabbit IgG, ProLong Gold antifade reagent with DAPI (4’, 6-diamidino-2-phenylindole) (Life technologies-Invitrogen, USA), ATP Affinity kit (no ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were rinsed three times with 1X PBS and coated with ProLong Gold antifade mounting medium with DAPI (4’,6-diamidino-2-phenylindole, 100 ng/ml) (Life Technologies, P-36931) on slides ...
-
bioRxiv - Molecular Biology 2022Quote: ... All sections were mounted with 50μl of ProLong Gold Antifade mounting media containing a fluorescent nucleic acid dye 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, P36931) before imaging ...
-
bioRxiv - Neuroscience 2023Quote: ... Slices were then stained with 4′,6-diamidino-2-phenylindole (DAPI) to stain cell nuclei and mounted with Immu-Mount mountant (Thermo Scientific, Cat# 9990402) onto microscope slides.
-
bioRxiv - Microbiology 2022Quote: ... and blocked for 45 min in 2% bovine serum albumin (BSA) in PBS prior to staining with DAPI (4=,6-diamidino-2-phenylindole) and mounted in Prolong Diamond antifade (Molecular Probes, Life Technologies). Images were captured using a Nikon Eclipse Ti confocal microscope (Nikon Instruments ...
-
bioRxiv - Genetics 2023Quote: ... and heart from 6 wild-type crucian carp at 4-month-age were dissected for total RNA extraction using Trizol (Thermo Fisher, CA, USA). RNA quality was measured using Nanodrop 8000 (Thermo Fisher ...
-
bioRxiv - Bioengineering 2023Quote: ... The slides were thoroughly rinsed and sealed utilizing a SlowFade Gold antifade reagent with 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, Thermo Fisher Scientific) and coverslips.44 The stained slides were imaged at 4x magnification with an EVOS fluorescence imaging system.
-
bioRxiv - Genetics 2024Quote: ... cell pellets were resuspended into PBS with 2% FBS and 1µg/ml of 4’,6-diamidino-2-phenylindol (DAPI) (Thermo Fisher Scientific, Cat#D1306) and transferred into 5 ml round bottom polystyrene flow tubes with cell strainer (Corning Life Sciences ...
-
bioRxiv - Developmental Biology 2021Quote: ... guide RNA for RBPMS2 (sequence 5’-GTCTTGCAGTGAGCTTGATC-3’) was synthesized using the T7 MegaShortScript transcription kit (Thermo Fisher Scientific). We previously described methods 28 to generate a doxycycline - inducible Cas9 line in the WTC-11 iPSC background (Coriell Institute) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 μL of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, concentration 5 mg/mL, Invitrogen, cat. M6494) in PBS was added to each well containing culture medium and incubated for 2.5 h at 37 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 nM biotinylated 685-bp DNA fragment (68% AT; Table S2) coupled to 3 μL M280 streptavidin dynabeads (ThermoFisher) was incubated with 5 nM prey DNA and H-NS in supplemented Filament Buffer at 5–8 μM 6:4 WT H-NS ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were washed 3 times with WB and nuclei were stained for 5 min with Hoechst 33342 (Life Technologies) in WB ...
-
bioRxiv - Bioengineering 2021Quote: ... 3% and 5% weight/volume (w/v) MeHA solutions were prepared in Dulbecco’s phosphate buffered saline (DPBS; ThermoFisher, 14190136) with 0.05% w/v Irgacure 2959 (I2959 ...
-
bioRxiv - Biochemistry 2020Quote: ... The staining solutions contained 5 μM CM-H2DCFDA or 3 μM MitoSOX™ (both Thermo Scientific, MA, Waltham, USA) diluted in HEPES/HSA for the detection of intracellular or mitochondrial ROS ...
-
bioRxiv - Neuroscience 2020Quote: ... the slices were rinsed 3 times in PBS and incubated in PBS with DAPI (5 μg/ml, Invitrogen, #D1306) and the following secondary antibodies at 4°C for 24 h ...
-
bioRxiv - Microbiology 2020Quote: ... a DNA fragment comprising the entire coding region of kpfR plus approximately 550 pb of 3’ and 5’ flanking regions (Table S4 in the supplemental material) was inserted on pCR2.1-TOPO vector (Invitrogen) previously cloned with erythromycin-resistance gene ...
-
bioRxiv - Cell Biology 2021Quote: ... and lifted for 3 min at 37°C using 5 mL of TrypLE Express (Invitrogen, Gibco, Cat no. #1260501). The appropriate number of cells were then spun down at 90 x g for 10 min at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... and lifted for 3 min at 37°C using 5 mL of TrypLE Express (Invitrogen, Gibco, Cat no. #1260501). The appropriate number of cells were then spun down at 90 x g for 10 min at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... washed 3 times with PBS 5 min each and mounted on glass slides using Prolong Diamond antifade reagent (Invitrogen). We prepared antibodies in PBS containing 3% BSA ...
-
Molecular architecture determines brain delivery of a transferrin-receptor targeted lysosomal enzymebioRxiv - Neuroscience 2021Quote: ... Sections were then rinsed in 1xPBS/0.05% Tween for 3 rounds of 5 minutes and incubated in DAPI (Invitrogen Molecular Probes D1306 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Red blood cells were removed by treatment with 3-5 mL of ACK lysis buffer (Gibco, Cat. No. A1049201) and a subsequent washing step in RPMI 1640 with 10% FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... These duplex reactions were run in triplicate (3 wells) on a QuantStudio 5 Real-Time PCR System (Thermo Fisher). One of two duplex assay pairings were used for each experiment ...
-
bioRxiv - Pathology 2020Quote: ... reverse primer 5’-cgaactCCG AGT TTA TAC TGC CCA GTT CG-3’ with FAM-labeled LUX (Cat. no19450335, Invitrogen). The mouse Vascular Endothelial Growth Factor assay ...
-
bioRxiv - Immunology 2020Quote: ... and reverse primer ENVN (5’ - TGCCAATCAGGGAAAAAGCCTTGTGTG - 3’. The envelope amplicons were purified, and ligated into pcDNA3.1D/V5-His-TOPO vector (Invitrogen). Chimeric envelope pseudoviruses were generated by swapping the V1V2 ...