Labshake search
Citations for Thermo Fisher :
8401 - 8450 of 10000+ citations for 6H 1 3 Dioxolo 4 5 g 1 benzopyran 6 one 7 8 dihydro since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... measured on a NanoDrop One (Thermo Fisher), and the protein’s predicted extinction coefficient at 280 nm (ε280).
-
bioRxiv - Biochemistry 2020Quote: ... coli (One Shot™ Star™, ThermoFisher) cells and spread on LBkan agar plates at 37 °C overnight ...
-
bioRxiv - Neuroscience 2020Quote: ... One Shot Stbl3(C737303, Invitrogen, CA, USA), serotyped with AAV1 coat proteins and produced by the University of North Carolina vector core facility (Chapel Hill ...
-
bioRxiv - Plant Biology 2021Quote: ... One mL of Trizol Reagent (Invitrogen, 15596018) was added to homogenized leaf tissue and resuspended ...
-
bioRxiv - Microbiology 2019Quote: ... one stored in RNAlater (Thermo Fisher Scientific) for RNA extraction and one snap frozen on dry ice for virus titration by TCID50 ...
-
bioRxiv - Microbiology 2019Quote: ... one stored in RNAlater (Thermo Fisher Scientific) for RNA extraction and one snap frozen on dry ice ...
-
bioRxiv - Bioengineering 2020Quote: ... and quantified using spectrophotometry (NanoDrop One, ThermoFisher). Plasmid construction was always validated to in silico sequences using Sanger sequencing.
-
bioRxiv - Cell Biology 2020Quote: ... No Sodium Pyruvate (Gibco))+20% Fetal Bovine Solution-One Shot (Gibco)+1% Glut Max 100x (Gibco)) ...
-
bioRxiv - Microbiology 2022Quote: ... One mL of TRIzol Reagent (ThermoFisher 15596018) was added to the lysate ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... A NanoDrop One spectrophotometer (Thermo Fisher Scientific) was used to determine RNA concentration and quality ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... A NanoDrop One spectrophotometer (Thermo Fisher Scientific) was used to determine RNA concentration and quality ...
-
bioRxiv - Neuroscience 2022Quote: ... 1X Culture One Supplement (Thermo Fisher Scientific), 1 µg/mL Laminin (R&D) ...
-
bioRxiv - Biochemistry 2022Quote: ... one stained with an anti-METTL7B (Invitrogen, Carlsbad ...
-
bioRxiv - Neuroscience 2019Quote: ... and 1x Culture One (Gibco A33202-01) in Neurobasal-A (Gibco 12349-015)) ...
-
bioRxiv - Cancer Biology 2020Quote: ... one for Gelcode staining (Thermo Fisher Scientific), and the other Western blot analysis to locate the membrane protein band by streptavidin-conjugated with horseradish peroxidase (HRP ...
-
bioRxiv - Microbiology 2021Quote: ... one stored in RNALater (Thermo Fisher Scientific) for RNA extraction and quantification of gene expression by RTqPCR and RNA-Seq ...
-
bioRxiv - Developmental Biology 2019Quote: ... and the following ones from Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... on the Step One Plus (ThermoFisher Scientific) or on the BioRAD CFX96 Real Time PCR system (Biorad) ...
-
bioRxiv - Neuroscience 2020Quote: ... One drop of NucBlue (Thermo Fisher Scientific) was added to the cell suspension and allowed to sit for 20 minutes (to aid in sorting and cell quantification) ...
-
bioRxiv - Biochemistry 2021Quote: One ShotTM Stbl3 (Fisher Scientific, Cat. # C737303)
-
bioRxiv - Cell Biology 2021Quote: ... and a NanoDrop One spectrophometer (ThermoFisher Scientific).
-
bioRxiv - Genomics 2021Quote: ... and quantified using NanoDrop One (Thermo Scientific). The RNA was serially diluted from 1011 to 104 cp/μL and used as input into the detection reaction ...
-
bioRxiv - Microbiology 2020Quote: ... coli One Shot PIR2 cells (Thermo Fisher), expressing λ pir ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... quantified by NanoDrop One (Thermo Fisher Scientific), and vacuum dried ...
-
bioRxiv - Microbiology 2022Quote: ... and ABI Step One system (Applied Biosystems) were used for quantitative RT-PCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... one protease inhibitor mini-tablet (Thermo Scientific) and Benzonase nuclease (Millipore) ...
-
bioRxiv - Cancer Biology 2022Quote: ... An UltraVision ONE Detection System (Thermo Fisher) was used following the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2022Quote: ... in Step-One plus from Applied Biosystems. gyrA was used as an internal control ...
-
bioRxiv - Microbiology 2022Quote: ... PichiaPink™ yeast strain one (Invitrogen, USA) was grown according to the instructions of the manufacturer ...
-
Glutamine synthetase mRNA releases sRNA from its 3’UTR to regulate carbon/nitrogen metabolic balancebioRxiv - Microbiology 2022Quote: ... RNA was quantified using NanoDrop One (Invitrogen). Total RNA (5 µg ...
-
bioRxiv - Genomics 2022Quote: ... A NanoDrop One (ThermoFisher Scientific, Waltham MA) spectrophotometer was used to quantify the genomic DNA and determine 260/280 and 260/230 nm ratios ...
-
bioRxiv - Microbiology 2022Quote: ... coli DH5α One Shot Top10 cells (Invitrogen). Transformants were selected based on Zeocin resistance (25 μg mL−1 ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1x Culture One (Gibco, #A33202-01) in Neurobasal-A (Gibco ...
-
bioRxiv - Neuroscience 2024Quote: ... with One Shot™ TOP10 (ThermoFisher Scientific) for allele-specific sequencing.
-
bioRxiv - Developmental Biology 2024Quote: ... using a NanoDrop One Spectrophotometer (ThermoFisher Scientific). Equal amounts of protein (0.25 µg ...
-
bioRxiv - Neuroscience 2024Quote: ... One µl of GlycoBlue co-precipitate (Invitrogen) was added to each sample and mixed well before the addition of 250 µl of isoproponol ...
-
bioRxiv - Plant Biology 2022Quote: ... a NanoDrop One spectrophotometer (Thermo Fisher Scientific) and Qubit 3.0 Fluorometer (Life Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... coli One Shot BL21 (DE3) (Life Technologies). The ARH1 D55,56A ...
-
bioRxiv - Genetics 2023Quote: ... and quantified with NanoDrop One (Thermo Fisher). One μg of the DNA was used as template for dsRNA synthesis using MEGAscript T7 Transcription kit (Thermo Fisher ...
-
bioRxiv - Biochemistry 2023Quote: ... coli strain One Shot™ TOP10 (Invitrogen) for plasmid amplification or BL21-CodonPlus (DE3)-RIPL Competent Cells (Agilent ...
-
bioRxiv - Biochemistry 2023Quote: ... One Shot BL21(DE3) (Invitrogen, 44-0184), OverExpress C43 (DE3 ...
-
bioRxiv - Cancer Biology 2023Quote: ... One Shot competent cells (Thermo Fisher Scientific) were transformed and candidate colonies were verified by diagnostic digestion ...
-
bioRxiv - Genetics 2023Quote: ... transformation was performed (One Shot Stbl3, Invitrogen). The inserted gRNA sequences were confirmed by Sanger sequencing ...
-
bioRxiv - Genetics 2023Quote: ... and quantified using Nanodrop One (Thermo Scientific). 100 nanograms for each of the three replicates from every sample were then used as a starting material to generate RNA-seq libraries following the Universal RNA-seq with NuQuant protocol (Tecan) ...
-
bioRxiv - Microbiology 2023Quote: ... SuperScript IV One Step RT-PCR (Invitrogen) and the forward primer 5’ TGGAACGTTGACCTGAGAGA 3’ and reverse primer 5’ AAGGATACGGTCCGTTCTGA 3’ were used to amplify a missing 689 bp section between the L1 and E6 genes ...
-
bioRxiv - Genomics 2023Quote: ... A NanoDrop One spectrophotometer (Thermo Fisher Scientific) was used to determine RNA concentration and quality ...
-
bioRxiv - Molecular Biology 2023Quote: ... and one µL GlycoBlue (Fisher Scientific, #AM9515) was added to seventy µL of the extracted aqueous phase ...
-
bioRxiv - Cancer Biology 2024Quote: ... containing one-part DMEM (Fisher Scientific; 41966029) and one-part DMEM/F12 (Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... FBS One Shot (1X, Thermo Fisher Scientific), Glutamax (1X ...
-
bioRxiv - Molecular Biology 2024Quote: ... quantified as IgG in Nanodrop One (Thermofisher) and stored at –20°C until further use.