Labshake search
Citations for Thermo Fisher :
8101 - 8150 of 10000+ citations for Glutathione Reductase Fluorescent Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... Each time 1 µg of good quality RNA was used for cDNA synthesis using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... 1-2 ug total RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific, #4368814). Real-time PCR was performed using specific primers for ACTN2 (GCTGAAGAAATTGTTGATGG ...
-
bioRxiv - Immunology 2021Quote: ... followed by click chemistry using EdC-labelled HSV-1 DNA and the Click-iT EdU Alexa Flour 555 Imaging Kit (ThermoFisher Scientific, C10638) according to the manufacturer’s instructions with AFDye 555 Picolyl Azide (Click Chemistry Tools ...
-
bioRxiv - Molecular Biology 2019Quote: ... cDNA was generated from 1 μg of RNA using random primers according to the protocol from the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher scientific) with RNase Inhibitor.
-
bioRxiv - Genomics 2021Quote: ... Random hexamer primers were used to reverse transcribe 1 µg of total RNA into cDNA using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific) in a thermocycler at 65°C for 5 min ...
-
bioRxiv - Genomics 2021Quote: ... First-strand cDNA was synthesised from 1 μg of mRNA for each sample using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, 4368814) with custom primers (Supp Table 4).
-
bioRxiv - Physiology 2021Quote: ... Total RNA (1 μg) was reverse transcribed into cDNAs using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, São Paulo, Brazil) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2021Quote: Genome DNA was extracted from A431 cells (wild type, clones #1 and #2) using GeneArt Genomic Cleavage Detection Kit (Thermo Fisher Scientific), following the manufacturer’s protocol ...
-
bioRxiv - Physiology 2020Quote: ... and lysed in a minimum of 5 µL Cells-to-CT buffer containing 1% DNAse I (Taqman Gene Expression Cells-to-CT Kit, Thermo Fisher Scientific), or a volume adjusted for a final cell concentration of ∼1000 cells/µL for 5 min at RT ...
-
bioRxiv - Bioengineering 2021Quote: ... These were then treated with 10 µM Ethidium Homodimer-1 and 5 uM Calcein AM from a Live/Dead Test Kit (Molecular Probes, Thermofisher Scientific) to a total volume of 250 uL PBS and incubated (37°C ...
-
bioRxiv - Physiology 2020Quote: ... DNAse-treated total RNA (1 µg) was used to generate cDNA using a High-Capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific). Gene expression was measured using gene-specific primers ...
-
bioRxiv - Developmental Biology 2021Quote: ... between 0.2-1 µg of RNA was reverse transcribed using Superscript III First Strand Synthesis kit (Life Technologies cat. no. 18080-051) and oligo-dT primers to generate cDNA libraries.
-
bioRxiv - Molecular Biology 2021Quote: ... pombe cells were mixed in an 8:1 ratio and total RNA was extracted using the RiboPure yeast kit (Ambion, Life Technologies) using the following volumes ...
-
bioRxiv - Genetics 2020Quote: ... The resulting amplicons were then partially digested and ligated to barcode adaptors (Ion Express barcode adaptors 1-96 kit, Thermo Fisher Scientific), which were then purified using a magnetic bead technology (AMPure XP Reagent ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 mM MgCl2) for cell membrane binding proteins (LPL, Caveolin 1) and quantified with Pierce™ BCA Protein Assay Kit (Buffer (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2021Quote: ... 1 μg of total RNA was used for cDNA synthesis using the M-MLV reverse Transcriptase Kit (Invitrogen Ltd, Carlsbad, CA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... 1 µg of intact RNA (with a 28S:18S rRNA ratio = 2:1) was reverse transcribed with the RevertAid H Minus Reverse Transcriptase kit (Thermo Scientific, EP0451). Real-time PCR reactions were performed with the Brilliant II SYBR® Green QPCR Master Mix (Agilent ...
-
bioRxiv - Genetics 2021Quote: SpG and SpRY mRNA were in vitro transcribed from DNA linearized by XbaI (1 μg) using the mMESSAGE mMACHINE™ T3 kit (Invitrogen, Thermo Fisher). In vitro transcribed mRNAs were DNAse treated using 1 μl TURBO-DNAse for 20 minutes at 37 °C and purified using RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative RT-PCR was performed by using TaqMan® RNA-to-Ct™ 1-Step Kit and a ViiA7 system (Thermo Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: Naïve CD8+ T cells were purified from the lymph node cells of Pmel-1 mice by negative selection using Invitrogen Magnisort CD8 Naïve T cell Enrichment kit (ThermoFisher, #8804-6825-74) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was diluted to 3 ng/µL and reverse transcribed and amplified using the Power SYBR Green RNA-to-CT 1-Step Kit (Thermo Fisher Scientific) to detect the presence of influenza A matrix gene (M-gene) ...
-
bioRxiv - Immunology 2020Quote: ... We used the High Capacity RNA-to-cDNA reverse transcription Kit using 1 μg messenger RNA per reaction (Life Technologies, Carlsbad, CA). Quantitative real-time polymerase chain reaction was performed using the ABI Prism 7000 Sequence Detection System (Life Technologies ...
-
bioRxiv - Immunology 2020Quote: ... quality control was performed in order to evaluate 1) the concentration of each sample using the Qubit dsDNA high sensitivity assay kit (Life Technologies, Q32854), and 2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... the mixture is cooled on ice for 1 minute before adding reagents for reverse transcription from the SuperScript III Reverse Transcriptase Kit (Invitrogen Cat. 18080093) along with 1 unit of RNaseOUT Recombinant RNase Inhibitor (Invitrogen Cat ...
-
bioRxiv - Neuroscience 2021Quote: ... Levels of murine Aβ (1–42) were measured by enzyme-linked immunosorbent assay (ELISA) using commercial kits (Thermo Fisher Scientific, cat# KMB3441) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... For HepaRG cells: 1 μg of total RNA was reverse transcribed into cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, UK). The reaction contained a mixture of 1 μl Reverse Transcriptase ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2-cell stage embryos were transferred to new KSOM containing 1 mM 5-ethynyl uridine (EU, from Click-iT RNA Alexa Fluor 488 Imaging Kit, Thermo Fisher Scientific) and cultured for 1h at 37°C with 5% CO2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... RT-qPCR analysis was performed using Power SYBR™ Green RNA to CT™ 1 step RT-PCR kit (Applied Biosystems, #4389986) on a QuantStudio 3 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Biophysics 2022Quote: ... Transfections were performed with 2 × 105 cells using 1 µg of plasmid by electroporation using a Neon electroporation kit (Thermo Fisher Scientific). Prior to imaging ...
-
bioRxiv - Microbiology 2022Quote: ... RNA samples were reverse transcribed with first strand synthesis primed with RT-primer 1 to 3 with a Maxima H Minus First Strand cDNA synthesis kit (Thermo Scientific, USA) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: MIEV and PKCα-KR cells (≥1 × 106/condition) were labelled with CellTrace Violet (CTV; 2 μM) using CellTrace™ Cell Proliferation Kits (Life Technologies) as described previously [14] ...
-
bioRxiv - Cancer Biology 2022Quote: CfDNA was isolated from 1 to 1.5 mL plasma from each sample using the MagMax™ Cell-free DNA Isolation Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Twenty-five nanograms of RNA was used as starting material per sample for qRT-PCR using the Power SYBR Green RNA-to-Ct 1-Step kit (Thermo Scientific, 4389986) on a Bio-Rad CFX96 thermocycler ...
-
bioRxiv - Cancer Biology 2022Quote: ... First-strand complementary DNA (cDNA) was generated from 1 μg of total RNA with the High-Capacity RNA-to-cDNA™ Kit (ThermoFisher Scientific). RT-qPCR was performed using TaqMan® Assays in 10 μL reaction mixtures ...
-
A stable reference human transcriptome and proteome as a standard for reproducible omics experimentsbioRxiv - Cell Biology 2022Quote: ... Cells were dissolved in 1% SDS lysis buffer (Beyotime, P0013G, China) and the protein concentration was measured using a BCA kit (ThermoFisher, 23227, USA). The protein digestion was performed by filter-aided sample preparation (FASP ...
-
bioRxiv - Cell Biology 2022Quote: ... at a ratio of 1:50 (w:w) for 16 h at 37 °C and iTRAQ reagents kit (Applied Biosystems, Framingham, MA, USA) were used to label 100 micrograms of digested proteins according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2022Quote: ... supernatant was used for analysis with GLP-1, Active form Assay Kit (Immuno-Biological Laboratories, Gunma, Japan) and microplate reader (Varioskan LUX, Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2022Quote: RNA from the Td-Tomato positive cells was extracted using trizol and qPCR was performed in triplicates by using the RNA to CT-1-step Sybr green kit (Life Technologies Ltd). Primers to detect transcripts of Hh and Wnt targets are in Supplementary Table 1.
-
bioRxiv - Cell Biology 2022Quote: ... 1-3 μg of total RNA was reverse-transcribed to cDNA using RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific K1621) according to the manufacturer instructions ...
-
Alpha-1-antitrypsin binds to the glucocorticoid receptor with biological significance in macrophagesbioRxiv - Immunology 2022Quote: Nuclear and cytoplasmic fractions of THP-1 macrophages were isolated using the NE-PER™ Nuclear and Cytoplasmic Extraction Reagents kit (ThermoFisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... or with 200 μL of Exosome Resuspension Buffer (1-2.5% Triton X-100) from the Total Exosome RNA and Protein Isolation Kit (Invitrogen, Thermo-Fisher Scientific) to lyse the EVs for proteomic analysis.
-
bioRxiv - Pathology 2022Quote: ... The one-step qRT-PCR reaction was carried out using the TaqMan® RNA-to-CtTM 1-step kit (Applied BiosystemsTM) on a QuantStudioTM3 Real-Time PCR system (Applied Biosystems). Reaction conditions and parameters were described previously (Price et al. ...
-
bioRxiv - Plant Biology 2022Quote: ... Reverse transcription (RT) of the extracted RNA samples (1 µg) was performed using AMV (Avian Myeloblastosis Virus) Reverse Transcription Kit (Invitrogen, Waltham, USA) and oligo-dT18 (1 µM ...
-
bioRxiv - Plant Biology 2022Quote: Shoot and root (1 μg) extracted as described above were used for cDNA synthesis using the SuperScript cDNA Synthesis Kit (Invitrogen, Massachusetts, USA) following manufacturer’s instructions to test the presence of multiple isoforms independent from Iso-Seq for a randomly selected gene set expected to express multiple isoforms ...
-
bioRxiv - Physiology 2022Quote: ... DNAse-treated total RNA (1 µg) was used to generate cDNA using a High-Capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific). Gene expression was measured using gene-specific primers (listed below) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Collection of RNA was followed by cDNA conversion using 1 µg RNA for each reaction with the Maxima First Strand cDNA Synthesis Kit (Thermo Scientific, K1642). Expression of the genes were determined using FastStart Essential DNA Green Master Kit (ROCHE ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA was synthesized from 1 μg of total RNA using oligodT and a High-fidelity cDNA synthesis kit (Thermo Scientific, Vilnius, Lithuania). The primers for quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Immunology 2022Quote: ... RNA-seq libraries were prepared with 1 ng of total RNA using an Ion AmpliSeq Transcriptome Mouse Gene Expression kit (Thermo Fisher Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... protein concentrations of fractions containing FtsZ1-2 and FtsZ2-1 were determined using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were purified on a 1% agarose gel and extracted using the GeneJET G el Extraction Kit (Thermo Fisher Scientific, Germany). The competent E ...