Labshake search
Citations for Thermo Fisher :
7851 - 7900 of 10000+ citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Zoology 2021Quote: ... Primers were verified by Basic Local Alignment Search Tool for specificity analysis and synthesized by Thermo Scientific Co. ...
-
bioRxiv - Plant Biology 2020Quote: ... from cDNA using the primers indicated in Supplemental Table 3 and transferred into pENTR-D-TOPO (Invitrogen) via Gibson assembly using NEB Gibson Assembly Master Mix according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Gene specific primers to SARS-CoV-2 (Wuhan v1, NSP14) and SYBR green master mix (Applied Biosystems) were used to amplify viral RNA and 18S rRNA primers were used to amplify cellular RNA using the QuantStudio 6 Flex RT-PCR system (Applied Biosystems) ...
-
bioRxiv - Systems Biology 2021Quote: ... and cDNA was synthesised with oligo-dT primers using the SuperScript IV First Strand Synthesis System (Invitrogen). The barcodes were then amplified from the cDNA and genomic DNA (gDNA ...
-
bioRxiv - Microbiology 2020Quote: ... Reverse transcription was performed using M-MLV Reverse Transcriptase and random primers following manufacturer's instructions (Invitrogen, USA). Quantitative PCR on reverse transcribed mRNA was performed using Mastermix (Applied Biosystems ...
-
bioRxiv - Plant Biology 2020Quote: ... A 2.1 kb sequence containing the NPF7.3 promoter was amplified from Arabidopsis genomic DNA by PCR using primers NPF7.3pro-topo-F and NPF7.3pro-R and cloned into pENTR/D-TOPO (pENTR-NPF7.3pro) (Invitrogen). The NPF7.3 promoter sequence was amplified again by PCR from the pENTR-NPF7.3pro construct using primer pairs NPF7.3pro-attL1-IF-F/NPF7.3pro-NPF7.3CDS-IF-R ...
-
bioRxiv - Microbiology 2019Quote: ... 1 μl of this primer pool was added to 1 μl of 10 mM dNTP mix (Invitrogen) and 11 μl of RNA ...
-
bioRxiv - Neuroscience 2021Quote: ... qPCR for fish samples were performed by primers in combination with Power SYBR Green (Thermo Fisher Scientific) using a ViiA7 real-time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was reverse-transcribed with random primers using the high-capacity cDNA synthesis kit (Thermo Fisher Scientific). Gene expression was monitored by quantitative real time PCR (qPCR ...
-
bioRxiv - Genomics 2020Quote: ... The resulting RNA was reverse transcribed using Multiscribe reverse transcriptase and a gene-specific primer (Thermo Fisher), and the cDNA was purified using alkaline lysis of the RNA followed by another round of AMPure bead purification.
-
bioRxiv - Immunology 2022Quote: ... Samples were amplified using adaptor specific primers and quantified using Qubit dsDNA high sensitivity kit (Thermo Scientific). Sample fragment size was determined using 4200 Tape Station (Agilent) ...
-
bioRxiv - Immunology 2022Quote: ... and RNA was reverse transcribed with random primers and M-MLV reverse transcriptase (Life Technologies, Carlsbad, CA) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Primers used to amplify the 5’/3’ junction with Phusion high-fidelity DNA polymerase (Thermo Fisher Scientific) are listed in Table S3 ...
-
bioRxiv - Genetics 2022Quote: ... RNA was reverse-transcribed with random primers using the high-capacity cDNA synthesis kit (Thermo Fisher Scientific). Sox2 gene expression was detected by allele-specific primers which specifically amplified either the musculus or castaneus allele as described in (Moorthy and Mitchell ...
-
bioRxiv - Immunology 2020Quote: ... 10 pM of each of forward and reverse primers and 1U of Taq DNA polymerase (Thermo Scientific). PCR cycling conditions were as follows ...
-
bioRxiv - Developmental Biology 2020Quote: ... Reverse transcription was performed using the M-MLV reverse transcriptase in combination with oligo (dT) primers (Invitrogen). The cDNA was used as a template for quantitative PCR analysis using the SybrGREEN® Master Kit (Roche ...
-
bioRxiv - Biochemistry 2021Quote: cDNA synthesis was performed in 20μL reactions consisting of 1μL random hexamer primers at 50ng/μL (Invitrogen), 1μL 10mM dNTPs (NEB) ...
-
bioRxiv - Immunology 2022Quote: ... Genes were amplified with the primers specified in Table S2 and Taq DNA polymerase (Thermo Fisher, US). Amplification was performed following an initial step at 95°C for 4 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10-mM primer mix and 5-μl SYBR green Select master mix CFX (Thermo Fisher, Cat. #4472942). Every reaction was done in triplicate and for every sample ...
-
bioRxiv - Microbiology 2019Quote: ... vRNA was reverse transcribed with Uni12/13 specific primers using Superscript IV First-Strand Synthesis System (Invitrogen) as per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... Total RNA was reverse transcribed with the specific primer (Supplemental Table 2) using SuperScript III system (Invitrogen). The RT product was amplified using Ex taq (TaKaRa ...
-
bioRxiv - Developmental Biology 2019Quote: ... and sequenced in both directions using M13 primers with the Big Dye® Terminator 3.1 (Applied Biosystems) sequencing template preparation method ...
-
bioRxiv - Biochemistry 2019Quote: ... and reverse transcribed using Oligo(dT)20 as a primer and Superscript III Reverse Transcriptase (Life Technologies) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10 ng of DNA and relevant primers were added to PowerUp SYBR Green Master Mix (Applied Biosystems) and real-time PCR performed using 7500 Fast Real-Time PCR System ...
-
bioRxiv - Genomics 2019Quote: ... Biotinylated primers and undigested inserts were removed as before using Dynabeads M-270 Streptavidin (Thermo Fisher Scientific). Ligation of pJDrcEPP_lib and minP-Luc2 inserts was performed at a 1:3 ratio as before but with T7 DNA ligase (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The remaining primers left in the reaction were digested by addition of 3μl ExoSAP-IT (Affymetrix, 75001) and incubation at 37 °C for 12 min ...
-
bioRxiv - Biochemistry 2019Quote: ... and complementary DNAs (cDNAs) were obtained by reverse transcription with oligo(dT) primers (Invitrogen, Carlsbad, CA, USA) and SuperScript II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... Primers (Table 1) were purchased from Integrated DNA Technologies (Belgium) and dNTPs were purchased from Thermo Scientific. All PCR products were gel-purified using the GeneJET Gel Extraction Kit (Thermo Scientific) ...
-
bioRxiv - Plant Biology 2021Quote: ... using gene-specific primers of candidate TFs (Table S2) and fluorescent dye SYBR™ Green (Applied Biosystems). Expression values relative to ACT2 were calculated with the comparative ΔΔCt method (Schmittgen and Livak ...
-
bioRxiv - Molecular Biology 2021Quote: ... a real-time primer elongation assay was established utilizing the fluorescence dye SYTO9 (Thermo Fisher Scientific, S34854), which binds to double-strand RNA but not single-strand RNA25,45 ...
-
bioRxiv - Molecular Biology 2020Quote: ... First strand cDNA was synthesized with a commercial kit using both oligo dT and random primers (Invitrogen). Second strand cDNA was synthesized with second strand synthesis buffer (Invitrogen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... according to the manufacturer’s protocol with the primers/probes Actb Mm02619580_g1 and Pdgfc Mm00480295_m1 (Thermo Fisher Scientific). Expression is represented relative to the housekeeping gene Actb ...
-
bioRxiv - Microbiology 2019Quote: ... Four µg of total RNA were reverse transcribed using random primers and M-MLV Reverse Transcriptase (Invitrogen), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... Reverse transcription was performed with the Uni12 primer (AGCAAAAGCAGG) using the Verso® cDNA kit (Thermo Scientific). PCR reactions were performed using Pfu Ultra II fusion 145 HS polymerase (Stratagene ...
-
bioRxiv - Genetics 2019Quote: ... cDNA was generated using 100ng total RNA and oligo dT primers with the Superscript III kit (Invitrogen). The cDNA reaction was diluted to 60 or 120µl with dH2O ...
-
bioRxiv - Genomics 2021Quote: ... 4 µL of the primer mix and 20 µL of KAPA HiFi Hotstart ReadyMix (Fisher Scientific KK2602) were added to the template and PCR was performed using the following conditions ...
-
bioRxiv - Genomics 2021Quote: ... 2.5 µL of the primer mix and 12.5 µL of KAPA HiFi Hotstart ReadyMix (Fisher Scientific KK2602) were added to the template and PCR was performed using the following conditions ...
-
bioRxiv - Biochemistry 2021Quote: ... Térèse cDNA with the primers specified in Table S3.and then recombined into the pDONR221 vector (Invitrogen). The suitable combination of AtKAI2 native promoter ...
-
Differential expression of transposable elements in stem cell lineages of the preimplantation embryobioRxiv - Developmental Biology 2020Quote: ... The first strand of cDNA was synthesized using random hexamer primers and Superscript II Reverse Transcriptase (Invitrogen). Second strand cDNA synthesis removed the RNA template and synthesized a replacement strand ...
-
bioRxiv - Bioengineering 2020Quote: ... 10 ng of cDNA was used in each well and Taqman primers were purchased from Thermo Fisher Scientific (RUNX2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and qPCR was performed using custom primers (Table S2) and PowerUp SYBR Green 2X Master Mix (ThermoFisher) on QuantStudio6 or 12k Real-Time PCR instruments (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2020Quote: ... they were used as matrices to synthesize cDNA using random primers and SuperScript II reverse transcriptase (Invitrogen). PCR was done on cDNAs using unlabelled ...
-
bioRxiv - Immunology 2020Quote: ... was reverse transcribed to cDNA with SuperScript III Reverse Transcriptase and oligo d(T)16 primers (Invitrogen). Quantitative real-time PCR was performed on Bio-Rad CFX thermal cyclers with TaqMan Gene Expression assays from Life Technologies (GAPDH ...
-
bioRxiv - Microbiology 2021Quote: ... and CDR20291_2932 (primers are listed in Supplemental Table 3) using PowerUp SYBR Green Master Mix (Applied Biosystems) and a QuantStudio 6 Flex Real-Time PCR machine (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μg of RNA was reverse-transcribed with oligodT and random primers using RevertAid Reverse Transcriptase (ThermoFisher) or the SuperScript™ IV First-Strand Synthesis System (Thermo Fisher) ...
-
bioRxiv - Immunology 2021Quote: ... 2 μL (10 μM) rev primer and nuclease free water) on an Arktik Thermal Cycler (ThermoFisher Scientific) with program ...
-
Bipartite viral RNA genome heterodimerization influences genome packaging and virion thermostabilitybioRxiv - Molecular Biology 2022Quote: ... Universal upstream (TGCATAATTCTCTTACTGTCATGCCATCCGTAAG) and downstream (TAAGAGAATTATGCAGTGCTGCCATAACCATG) primers were used to target the backbone of pMT plasmids (Invitrogen). Overlapped PCR fragments were generated (Phusion High-Fidelity DNA Polymerase ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA was synthesized using SuperScript II Reverse Transcriptase with Oligo (dT) 12-18mer Primers (Thermo Fisher Scientific) using Mastercycler X50i (Eppendorf ...
-
bioRxiv - Cell Biology 2022Quote: ... 200 ng of total RNA were used to synthesize cDNA using oligo (dT)12-18 primer (Invitrogen by Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... The expression of the N1 gene was performed using specific primers and probes TaqMan Assay (Applied BioSystems, Thermo Fisher Scientific ...