Labshake search
Citations for Thermo Fisher :
8051 - 8100 of 10000+ citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... PCR amplification was performed using Platinum™ II Hot-Start PCR Master Mix (2X) (Invitrogen, CA, USA) and 3 sets of primers (Table S1 ...
-
bioRxiv - Microbiology 2021Quote: ... Real-time PCR was performed using a QuantStudio 6 Flex Real-Time PCR detection system (Thermo Fisher) and PerfeCTa SYBR Green FastMix (Quantabio ...
-
bioRxiv - Microbiology 2021Quote: ... Viral transcripts were detected by qRT-PCR using the Platinum Quantitative PCR SuperMix-UDG with ROX (ThermoFisher). Primer and probe sets used for qRT-PCR assays are as follows ...
-
bioRxiv - Plant Biology 2020Quote: ... The qRT-PCR was performed using a StepOne Plus Real-Time PCR Thermo-cycler (Fisher Scientific, Canada), with an initial GoTaq® Hot Start Polymerase activation step at 95 °C for 2 minutes ...
-
bioRxiv - Genetics 2020Quote: ... PCR products were then cloned into pJET1.2 using the blunt end CloneJET PCR Cloning Kit (Thermo Scientific). Two rounds of high fidelity PCR was used to generate linear mNG repair templates with 35bp homology arms as previously described (Paix et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... and subjected to quantitative real-time PCR with the Power SYBR Green PCR Master Mix (Thermo Scientific) on StepOnePlus Real-Time PCR System (Thermo Scientific) ...
-
Cryptococcus neoformans secretes small molecules that inhibit IL-1β inflammasome-dependent secretionbioRxiv - Immunology 2019Quote: ... qRT-PCR was performed using SyBr Green Master Mix and StepOne real-time PCR system (Applied Biosystems). The primer sequences were as follows ...
-
bioRxiv - Immunology 2020Quote: ... The real-time PCR was performed on QuantStudio™ 7 Flex Real-Time PCR System (Thermo Fisher). Reactions were performed in triplicates in a final reaction volume of 10 μl containing 5 μl of iQ™ SYBR® Green Supermix (Biorad ...
-
bioRxiv - Immunology 2020Quote: ... Viia 7 Real Time PCR system with a Power SYBR green PCR master mix kit (Applied Biosystems).
-
bioRxiv - Molecular Biology 2019Quote: ... Real time PCR step quantification was performed on ViiA 7 real time PCR system (Thermo Fisher Scientific).
-
bioRxiv - Genetics 2021Quote: ... Real-time PCR was performed with SYBR green using an ABI7300 Real time PCR Instrument (Applied Biosystems). Expression of the various genes was determined by the comparative CT method (ABI Prism 7700 Sequence Detection System User Bulletin #2 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... A quantitative PCR was performed on a PikoReal 96 Real-Time PCR machine (Thermo Fisher Scientific TCR0096) using 0.2 % of the unamplified library and the following thermal profile ...
-
bioRxiv - Genetics 2021Quote: ... These diagnostic PCRs were performed using desalted oligonucleotides and the DreamTaq PCR master Mix (Thermo Fisher Scientific) according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2020Quote: ... and 7900HT Fast Real-Time PCR System (Applied Biosystem) using SYBR Green PCR Master Mix (Life Technologies) and gene-specific primers ...
-
bioRxiv - Microbiology 2021Quote: ... qRT-PCR analysis was completed using the Superscript III Platinum one-step qRT-PCR kit (Life Technologies). Cycling conditions were ...
-
bioRxiv - Microbiology 2020Quote: ... All qRT-PCR was completed using the Superscript III platinum One step qRT-PCR kit (Life Technologies) following manufacturer’s instructions for reaction set up ...
-
bioRxiv - Microbiology 2020Quote: ... All PCRs were carried out using high-fidelity 2X Platinum SuperFi® Green PCR Master Mix (Invitrogen). The high fidelity directional In-Fusion® HD Cloning Kit (Takara Bio USA ...
-
bioRxiv - Biochemistry 2021Quote: ... Quantitative PCR was performed according to manufacturer’s specifications on a StepOnePlus Real-Time PCR System (Thermo Fisher) using PerfeCTa® SYBR® Green SuperMix (Quantabio ...
-
bioRxiv - Molecular Biology 2021Quote: ... The cDNAs were subjected to quantitative real-time PCR using SYBR Green PCR master mix (Applied Biosystems) and ViiA 7 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Neuroscience 2021Quote: PCR amplifications were performed using Phusion High-Fidelity PCR Master Mix with HF Buffer (Thermo Fisher Scientific) following manufacturer instructions unless otherwise is specified.
-
bioRxiv - Neuroscience 2021Quote: ... PCR amplifications were performed employing Phusion High-Fidelity PCR Master Mix with HF Buffer (Thermo Scientific™) following manufacturer’s recommendations.
-
bioRxiv - Genetics 2021Quote: ... and Real-time PCR reactions were performed using the Power SYBR Green PCR Master Mix (Applied Biosystems) on the 7900HT Fast Real Time PCR System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative real-time PCR was performed on a real-time PCR system (QuantStudio 6 Flex, Applied Biosystems) with SYBR Green PCR Master Mix (Life Technologies) ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative real-time PCR (qRT-PCR) was carried out using SYBR green master mix (Applied Biosystems™) in a StepOne Plus thermal cycler (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Quantitative reverse transcription gene amplifications (qRT-PCR) were performed with StepOnePlus Real-Time PCR System (Applied Biosystems) using the Power SYBR Green PCR Master Mix (Applied Biosystems) ...
-
bioRxiv - Immunology 2021Quote: ... Quantitative PCR (qPCR) was performed on cDNA using Power SYBR Green PCR master mix (Thermo Fisher Scientific) on Bio-Rad (Bio-Rad Laboratories ...
-
bioRxiv - Immunology 2021Quote: ... ChIP-DNA underwent qRT-PCR using a TaqMan® 7900HT Fast Real-Time PCR System (Applied Biosystems) per manufacturer’s recommendations ...
-
bioRxiv - Immunology 2021Quote: ... and quantitatively detected by real-time PCR using the TaqMan® Universal PCR Master Mix (Life Technologies) with primers (forward primer - 5’ CCCATGTTTTCAGCATTATCAGAA 3’ and reverse primer-5’ CCACTGTGTTTAGCATGGTGTTTAA 3’ ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative PCR (qPCR) analysis was performed using an Applied Biosystems 7500 Fast Real-Time PCR system (ThermoFisher) and Brilliant II SYBR Green Master Mix (600830 ...
-
bioRxiv - Molecular Biology 2021Quote: ... the above three PCR fragments were cloned into XhoI/SpeI-digested pCR Blunt II-TOPO vector (Invitrogen) using the HiFi DNA Assembly Cloning kit (New England Biolabs).
-
bioRxiv - Immunology 2020Quote: ... and the real-time PCR reaction was performed on the 7500 Real-Time PCR System (ABI, ThermoFisher). The primers used for the real-time PCR are listed in Supplementary Table 1.
-
bioRxiv - Immunology 2021Quote: ... Mycoplasma analysis was performed with Mycoplasma species 500 PCR kit at GeneAmp PCR System 2700 (Applied Biosystems). Quality control tests of the vaccine including levels of chemistry analysis (Na ...
-
bioRxiv - Immunology 2021Quote: ... All qRT-PCR assays were performed on QuantStudio™ 3 Real-Time PCR System (Thermo Fisher®).
-
bioRxiv - Genetics 2019Quote: ... PCR products were cloned into the pCR™4-TOPO® TA vector (Invitrogen, Carlsbad, California, US) and sent for sequencing (Macrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... qRT-PCR reactions were carried out using SYBR green PCR master mix (Applied Biosystems, Carlsbad, CA, USA), in an CFX384 instrument (Bio-Rad ...
-
bioRxiv - Neuroscience 2021Quote: ... All Q-PCRs were performed in 20 μL volumes using SYBR Green PCR master mix (Applied Biosystems) in a 96-well optic tray using a CFX96 Real-Time PCR machine (Bio-Rad) ...
-
Rac1, Rac3 GTPases and TPC2 are required for axonal outgrowth and migration of cortical interneuronsbioRxiv - Neuroscience 2022Quote: ... Real time PCR analysis was performed using a Step One Plus real-time PCR system (Applied Biosystems, Life Technologies ...
-
bioRxiv - Developmental Biology 2022Quote: Quantitative PCR (qPCR) analysis was carried out on a StepOnePlus™ Real-Time PCR System (Life Technologies) using Power SYBR® Green PCR Master Mix (Promega #A6002) ...
-
bioRxiv - Microbiology 2022Quote: ... Quantitative PCR (qPCR) analysis was conducted using a QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems). A ...
-
bioRxiv - Bioengineering 2022Quote: ... Quantitative real-time PCR (qPCR) was then performed using SYBR Green PCR Master Mix (#4309155; Thermo Fisher) with the LightCycler® 480 device (Roche) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The qRT-PCR experiments were performed with a Power SYBR® Green PCR Master Mix (Thermo Fisher) and specific primers listed as following ...
-
bioRxiv - Bioengineering 2022Quote: ... Real-time quantitative PCR (qPCR) was performed using the SYBR Green PCR Master Mix (Applied Biosystems, 4309155). Primer sequences ...
-
bioRxiv - Biochemistry 2022Quote: ... Quantitative real-time PCR was performed using Power SYBR® Green PCR Master Mix (Applied Biosystems, 4368577) and PCRs were performed in a QuantStudio 5 cycler (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Purified PCR products were included into the PCR-II TOPO vector using TOPO-TA cloning kit (InVitrogen), and clones containing CXCL12 sequence with BstbI and PmlI restriction sites respectively in 5’ and 3’ ends of the coding sequence were selected ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... qRT-PCR on each biological replicate was carried out using Power SYBR PCR master mix (Thermo Fisher) and in technical triplicates each time ...
-
bioRxiv - Molecular Biology 2022Quote: ... Real-Time quantitative PCR reactions (qRT) were performed in a thermocycler Real-Time StepOnePlus PCR (Applied Biosystems) with a final volume of 14 μl using reagent SYBR Green Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... PCR conditions followed the TaqMan™ Universal PCR Master Mix protocols (Thermo Fisher Scientific, Waltham, MA, USA). Quantification of gene expression was conducted using StepOne™ (Applied Biosystems) ...
-
bioRxiv - Immunology 2022Quote: ... Deconvolutions were confirmed by cloning the PCR products using a ZERO BLUNT PCR cloning kit (Life Technologies) and sequencing individual clones.
-
bioRxiv - Developmental Biology 2022Quote: ... The resulting PCR product was first cloned into the topo vector pCR-Blunt-II-Topo (ThermoFisher Scientific) to generate pRA46 ...
-
bioRxiv - Physiology 2022Quote: ... Real time quantitative PCR was carried out with QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems) using TaqMan Universal PCR master mix (Applied Biosystems ...