Labshake search
Citations for Thermo Fisher :
7151 - 7200 of 10000+ citations for 6H 1 3 Dioxolo 4 5 g 1 benzopyran 6 one 7 8 dihydro since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... incubated for 5 min at 37 °C with 4 ml pre-warmed TrypLE 1X Express (Gibco), quenched with pre-warmed growth medium ...
-
bioRxiv - Cell Biology 2021Quote: ... and boiled for 5 minutes before fractionating on a 4–12% NuPAGE Bis-Tris gel (Invitrogen). Proteins on a gel were transferred to a nitrocellulose membrane and analyzed by using the antibodies at 1:3000-10,000 dilutions ...
-
bioRxiv - Cell Biology 2022Quote: ... and centrifuged at 1000 rpm for 5 min at 4°C (accuSpin Micro 17R; Fisher Scientific). The proteins were extracted in 50 mM Tris buffer (pH 7.8 ...
-
bioRxiv - Immunology 2022Quote: ... 4×104 sorted peritoneal and thymic macrophages were stained with 5 µM eFluor 450 (Thermo Fisher) in PBS for 10 min at 37℃ ...
-
bioRxiv - Developmental Biology 2024Quote: ... and cells were passaged every 4-5 days using 0.5 mM EDTA (Life Technologies, #15575-020) to dissociate cells maintaining clumps ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: GL261 cells (4 × 107/mL) were incubated with 5 μM CFSE solution (Invitrogen Molecular Probes, USA) diluted in PBS for 15 min at 37 °C ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: GL261 cells (4 × 107/mL) were incubated with 5 μM CFSE solution (Invitrogen Molecular Probes, USA) diluted in PBS for 15 min at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with L-glutamine (4 mM) and 5% foetal bovine serum (Thermo Scientific, Waltham, MA, USA). Cell culture medium was supplemented with 0.1 mM NaI and 1 mM NaBr (to model physiological availability of iodine and bromide) ...
-
bioRxiv - Microbiology 2023Quote: ... and boiled for 5 min before separation on a 4-12% NuPAGE Bis-Tris gel (Invitrogen) for immunoblotting.
-
bioRxiv - Developmental Biology 2022Quote: RNA was isolated from 4-5 pairs of ovaries with TRIzol reagent (Invitrogen Catalogue No. 15596026) and cDNA was synthesized from 1µg of RNA ...
-
bioRxiv - Cell Biology 2023Quote: ... Stage 4 hippocampal neurons (5–10 DIV) were transfected with Lipofectamine 2000 (Thermo Fisher, Cat# 11668019). The following expression times were used ...
-
bioRxiv - Plant Biology 2023Quote: ... 5 µl of each sample was loaded to NativePAGE 4 to 16% bis-tris gels (Invitrogen). Proteins were transferred to PVDF membranes with NuPAGE Transfer Buffer (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... washed 4 x 5 min in PBST and mounted with ProLong Gold Antifade Mountant (Invitrogen, #P36935) under coverslips (VWR ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were passaged every 4–5 d with UltraPure 0.5 mM EDTA (Thermo Fisher Scientific, 15575020). For the generation of 3D neural organoids ...
-
bioRxiv - Biochemistry 2023Quote: ... Each well was loaded with 100 µL of a 5 µM Fluo-4 AM (Molecular Probes) solution in imaging buffer (20 mM HEPES ...
-
bioRxiv - Cell Biology 2023Quote: ... and boiled for 5 minutes before fractionating on a 4–12% NuPAGE Bis-Tris gel (Invitrogen) and transferred to nitrocellulose membrane ...
-
bioRxiv - Immunology 2023Quote: ... pre-coated (5 μg cm−2) 4-well chamber slide (Thermo Fisher Scientific, cat. no. 154526). A fluorescence image was captured using an LSM 880 confocal microscope (Carl Zeiss AG ...
-
bioRxiv - Microbiology 2023Quote: ... 50 µg/ml gentamycin sulfate) supplemented with 4 to 5 µg/ml ConA (Thermo Scientific AAJ61221MC). To determine the effects of type I interferons ...
-
bioRxiv - Cell Biology 2022Quote: ... about 5×104 of transfected cells were digested and placed into the upper chamber precoated 8 μm pore transwell insert (Fisher Scientific, 0877121) with the lower chamber containing the medium (containing 10% FBS) ...
-
bioRxiv - Microbiology 2021Quote: ... and 2×105 cells were seeded into 24-well culture plates or 5×104 cells into Lab-Tek II 8-well chamber slides (Nunc/Thermo Fisher). To account for donor variations ...
-
bioRxiv - Microbiology 2020Quote: ... Cover slips were then washed three times for 5 min in wash buffer and subsequently mounted on slides with 8 μl of prolong glass (Invitrogen, cat. # P36984) or mowiol ...
-
bioRxiv - Molecular Biology 2020Quote: ... protein samples were boiled at 95°C for 5 min before separating on Novex WedgeWell 8–16% Tris-Glycine Mini Gels (Thermo Fisher Scientific). Protein samples were transferred to polyvinylidene fluoride membrane (GE Healthcare) ...
-
bioRxiv - Developmental Biology 2021Quote: ... H9 cells were cultured at 37°C and 5% CO2 in feeder-free conditions in Essential 8™ (E8 medium (Gibco, Life Technologies, Carlsbad ...
-
bioRxiv - Microbiology 2020Quote: ... HCT-8 human ileocecal colorectal adenocarcinoma cell line and its 5-FU-resistant was cultured in RPMI 1640 medium (Gibco, New Zealand) containing 10% fetal bovine serum (FBS) ...
-
bioRxiv - Immunology 2020Quote: Lymphocytes from peripheral lymph nodes and spleen from 8-12 weeks old BALB/c mice were harvested and stained with 5 μM Cell Trace Violet proliferation dye (Thermo Fisher, C34557) in PBS for 10 minutes at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... and blotted for 1.5 s before being plunged into liquid ethane in 100% humidity at 8 °C using a Mark IV Vitrobot (Thermo Fisher Scientific). The datasets of Csy-DNA complex samples were collected using a Titan Krios microscope (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2021Quote: ... in the presence of 1/5 biotin-16-dUTP (JenaBioscience, NU-803-BIO16-L) to dTTP (ThermoFisher, 10520651). The PCR was done with primer CD21 (GACCGAGATAGGGTTGAGTG ...
-
bioRxiv - Neuroscience 2019Quote: ... and 5% goat serum in PBS for 1 hour at room temperature or blocked with Starting Block (ThermoFisher) with 0.3% TritonX-100 for 1 hour at room temperature and then incubated overnight at 4°C with the primary antibodies rabbit anti-Iba-1 (Wako ...
-
bioRxiv - Microbiology 2022Quote: ... the media was replaced with selection media containing 1 µg/mL puromycin or 5 µg/mL blasticidin (ThermoFisher) and cells were selected for 48 h before proceeding with experiments.
-
bioRxiv - Neuroscience 2021Quote: ... and plasmidic DNA (0.9µg/µL) in a 1:5 ratio were separately pre-incubated with Opti-MEM (Gibco). Lipofectamine 2000 and plasmidic DNA were left to complex for 20 minutes at room temperature and added to the plated BV2 cells in low glucose DMEM supplemented with 5% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2019Quote: ... RNA (5 ng µl−1) was reverse transcribed using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). 1 µl of cDNA was used as a template in a 10 µl qRT-PCR reaction performed with Power SYBR reagent (Applied Biosystems) ...
-
bioRxiv - Microbiology 2019Quote: Ligation reactions were performed with a 1:5 ratio of vector:insert using T4 DNA Ligase (15224017, ThermoFisher Scientific) in a 20ul reaction as per manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... Cells were washed with PBS four times and blocked using 1% BSA and 5% normal goat serum (Invitrogen) in PBS for 1 hour ...
-
bioRxiv - Bioengineering 2021Quote: ... All samples were then incubated with nucgreen™ Dead 488 (Invitrogen™, 1 drop/5 ml in PBS) overnight for spheroids and 4 h for cell monolayers ...
-
bioRxiv - Bioengineering 2020Quote: ... and fusion medium (low-serum medium - 94 % Dulbecco’s Modified Eagle’s Medium, Gibco, 5 % horse serum, 1 % antibiotic/ antimycotic Gibco) were changed every other day ...
-
bioRxiv - Immunology 2020Quote: ... Tissue sections were then stained with DAPI (Thermo Fisher Scientific, USA, 1:5000, 5 min at 37°C) with subsequent mounting with Prolong Diamond Antifade mountant (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: Samples of RNA from SKM-1 and MS-5 co-cultures were collected and extracted using Trizol (Invitrogen) following manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... or 5 µl of EZ-Link™ Sulfo-NHS-Biotin (21217, Thermo Fisher Scientific, 1 µg/20 µl), while still attached via the umbilical cord to the mother’s blood circulation ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... + 5% BCS + 0.4 ug/ml hydrocortisone + 10 ng/ml epidermal growth factor (EGF) + 1% Penicillin-Streptomycin (ThermoFisher Scientific). After two days incubation ...
-
bioRxiv - Genetics 2022Quote: 5 µL of RT-qPCR reaction was digested with 1 µL FastDigest PstI restriction enzyme (#FD0614, ThermoFisher Scientific) for 1 h at 37°C ...
-
bioRxiv - Plant Biology 2022Quote: ... an additional cleaning step with acid phenol was added before precipitation of the RNA by adding an equal volume of Acid-Phenol:Chloroform 5:1 solution pH 4.5 (Ambion). Total RNA was quantified with a Nanodrop 2000 spectrophotometer (Thermo Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... to stain AAV2/5-GfaABC1D::eGFP and Alexa 488 anti-chicken (1:400, Thermo Fisher Scientific, The Netherlands). Finally ...
-
bioRxiv - Biochemistry 2020Quote: THP-1 cells (ATCC, TIB-202) were cultured at 37°C with 5% CO2 in RPMI 1640 (Invitrogen) supplemented with 10% heat inactivated FBS (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... Between 1 and 5 μg of RNA was boiled at 95 °C with Gel II Loading Buffer (Invitrogen) and loaded on a urea-PAGE gel (Sequagel ...
-
bioRxiv - Immunology 2019Quote: ... An eight-point dilution series of patient serum diluted at 1:5 in DMEM (Gibco, Life Technologies, USA) supplemented with 2% FBS were incubated with a constant amount of DENV1 - West Pac 74 and DENV-2 S16803 ...
-
bioRxiv - Immunology 2019Quote: ... An eight-point dilution series of patient serum diluted at 1:5 in DMEM (Gibco, Life Technologies, USA) supplemented with 2% FBS were incubated with a constant amount of DENV1 - West Pac 74 and DENV-2 S16803 ...
-
bioRxiv - Cell Biology 2019Quote: ... for 10 minutes, and fixed with methanol:glacial acetic acid, (5:1, v/v) (FisherThermo Fisher Scientific, Rockford, IL). Cells were dropped onto slides ...
-
bioRxiv - Genetics 2020Quote: ... and in some cases day 5 (120 hours) by staining with SYBR Green 1 nucleic acid stain (Invitrogen, ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... for 1-3h at 37°C in a HERAcell 150i or 160i 5% CO2 incubator (Thermo Fisher Scientific). Cells were washed in 1x PBS and fixed in 10% neutral buffered formalin (HT501128 ...
-
bioRxiv - Physiology 2021Quote: ... at a concentration of 1:500 for 5 min and mounted in SlowFade Diamond Antifade Mountant (ThermoFisher, S36967). Images were captured using a Leica TCS SP5 Confocal Microscope and processed using Fiji (ImageJ ...