Labshake search
Citations for Thermo Fisher :
651 - 700 of 10000+ citations for TIM 3 Human HEK 293 Fc His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... 20 μg of the plasmid was transfected into 20 mL of Expi293F cells at 3 × 106 cells mL-1 using ExpiFectamine 293 Transfection Kit (Thermo Fisher Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Cells grown to a density of 3 million per mL were transfected using the respective plasmids with the ExpiFectamine™ 293 Transfection Kit (ThermoFisher Scientific) and cultivated for 5 days ...
-
bioRxiv - Microbiology 2023Quote: ... Expi293F cells were diluted to a density of 3 million cells per mL and transfected using ExpiFectamine 293 Transfection Kit (Thermo Fisher Scientific). Cells were incubated shaking at 130 rpm at 37°C and 8% CO2 ...
-
bioRxiv - Immunology 2021Quote: ... The pcDNA 3.1+ vectors were then transfected individually into human embryonic kidney (HEK293T) suspension cells using ExpiFectamine 293 transfection reagent (ThermoFisher Scientific, Waltham, MA, USA) following manufacturer’s specifications ...
-
bioRxiv - Immunology 2023Quote: ... post-dose 3 and 6-months post-dose 3 using mouse anti-human IgG1 biotin (Thermo Fisher Scientific) and mouse anti-human IgG4 biotin (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2021Quote: HEK 293F cells (Thermo Fisher Scientific 12338026) and mAb 2F2 and 2E10.E9 hybridoma cell lines (BEI Resources MRA-184 and -185 ...
-
bioRxiv - Immunology 2019Quote: HEK-293FT cells (ThermoFisher; cat. no. R70007) were cultured in a six-well plate at a concentration of 5 × 105 cells/ml ...
-
bioRxiv - Cell Biology 2021Quote: HEK 293FT cells (Thermo Fisher Scientific R70007) and B16-F1 mouse melanoma cells (ATCC CRL-6323 ...
-
bioRxiv - Cell Biology 2020Quote: HEK cells were cultured in DMEM (Gibco) with 10% heat-inactivated FBS (Gibco) ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK were cultured in EpiLife medium (Gibco), supplemented with 0.6 mM CaCl2 (Gibco) ...
-
bioRxiv - Neuroscience 2020Quote: ... suspension HEK-Expi293F™ cells (ThermoFisher Scientific) were cultured in Expi293™ expression media (Gibco ...
-
bioRxiv - Molecular Biology 2019Quote: 5.5 × 106 HEK 293T cells (Thermo Fisher) attached to 10 cm cell culture dishes (Sarstedt ...
-
bioRxiv - Immunology 2022Quote: HEK-293T was grown in DMEM (Gibco) supplemented with 10% FCS (Gibco) ...
-
bioRxiv - Genomics 2022Quote: ... HEK 293T was obtained from Life Technologies. K562 was authenticated by Short Tandem Repeat profiling (Genetica ...
-
bioRxiv - Genomics 2023Quote: ... HEK 293FT cells were obtained from ThermoFisher Scientific (R70007 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The HEK-293T cells (Thermo-Fisher Scientific) were maintained in Dulbecco’s modified Eagle media (DMEM ...
-
bioRxiv - Systems Biology 2021Quote: ... Tn5 underwent a His-tag (Dynabeads His-Tag Isolation & Pulldown, Invitrogen, 10103D) clean-up according to the manufacturer’s protocol to remove unbound oligos before using.
-
bioRxiv - Cell Biology 2023Quote: ... Human embryonic kidney (HEK) 293T cells were from ATCC (cat. #CRL-3216) and were cultured in high-glucose DMEM (Gibco, cat. #41966-052) supplemented with 10% FBS and 1% Penicillin-Streptomycin.
-
bioRxiv - Immunology 2022Quote: ... anti-Human CD223(LAG-3) antibody (Invitrogen, eBioscience,, Percp-efluor™710), anti-Human CD45RA antibody (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... were transfected with human myosin VI siRNA duplex (5′GGUUUAGGUGUUAAUGAAGtt-3′) (Ambion) or AllStars Negative Control siRNA duplex (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... 10% HI FBS (Gibco), 1X ultraglutamine (Lonza) ...
-
bioRxiv - Microbiology 2021Quote: ... His (ThermoFisher, MA1-21315), FLAG (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... anti-His mAb (Invitrogen) and anti-GAPDH mAb (Life Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... HI FBS (2273356P, Gibco). HEPES (54457 ...
-
bioRxiv - Immunology 2020Quote: ... or anti-His (Invitrogen) for recombinant ZVrecE80 antigen in 0.1M carbonate buffer pH 9.6 ...
-
bioRxiv - Microbiology 2022Quote: ... anti-penta HIS (Invitrogen) and anti-HSP70 (26 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10% HI-FBS (Gibco), 1% penicillin/streptomycin (Gibco) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10% HI-FBS (Gibco), 1% penicillin/streptomycin (Gibco) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10% HI-FBS (Gibco), 1% penicillin/streptomycin (Gibco) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and His-tag (Invitrogen) were used ...
-
bioRxiv - Molecular Biology 2020Quote: ... supplemented with 10% FCS (FCS; Invitrogen; Thermo Fisher Scientific, Inc.). When the cultured cells reached 70-80% confluence at 37° C in a humidified 5 %CO2 incubator ...
-
bioRxiv - Molecular Biology 2020Quote: ... supplemented with 10% FCS (FCS; Invitrogen; Thermo Fisher Scientific, Inc.). When the cultured cells reached 70-80% confluence at 37° C in a humidified 5 %CO2 incubator ...
-
bioRxiv - Molecular Biology 2020Quote: P2 virus was added to 2.0 million per ml of Freestyle™ 293-F Cells (Themofisher Scientific) in Gibco FreeStyle 293 Expression Medium (Invitrogen) at a final volume of 10% at 37 °C and 5% CO2 ...
-
bioRxiv - Immunology 2023Quote: ... The plasmids were co-transfected into FreeStyle 293 F cells that were cultured in FreeStyle 293 Expression Media (Gibco #12338018) using Fectopro (Polyplus ...
-
bioRxiv - Immunology 2020Quote: ... and reverse primer ENVN (5’ - TGCCAATCAGGGAAAAAGCCTTGTGTG - 3’. The envelope amplicons were purified, and ligated into pcDNA3.1D/V5-His-TOPO vector (Invitrogen). Chimeric envelope pseudoviruses were generated by swapping the V1V2 ...
-
bioRxiv - Immunology 2020Quote: ... were coated at room temperature for 3 hours with 1 μg/mL PolyRab anti-His antibody (ThermoFisher, PA1-983B), followed by overnight blocking with blocking buffer containing 1x PBS ...
-
bioRxiv - Biophysics 2023Quote: ... and from the 3’-terminus by the 10×His-tag nucleotide sequence and inserted into a pFastBac1 vector (Invitrogen) via the BamHI(5’ ...
-
bioRxiv - Biophysics 2023Quote: ... and from the 3’-terminus by 10×His-tag nucleotide sequence and inserted into the pFastBac1 vector (Invitrogen, USA) via the BamHI(5’ ...
-
bioRxiv - Microbiology 2023Quote: ... we initially digested the pNL4-3 plasmid with EcoRI and XhoI and subcloned this fragment into pcDNA3.1/myc-His A (Invitrogen). To generate pcDNA3.1 NL4-3 Env TMTR ...
-
bioRxiv - Molecular Biology 2021Quote: ... Flp-In™ T-REx™-293 (Invitrogen) cells were seeded in 6-well culture plate to reach 70% confluency ...
-
bioRxiv - Genomics 2020Quote: Flp-In T-REx 293 (HEK293-derived; Invitrogen) and HEK293T (American Type Culture Collection ...
-
bioRxiv - Immunology 2021Quote: ... in FreeStyle™ 293 Expression Medium (Thermofisher Scientific) according to the manufacturer’s protocol and incubated for at least 15 minutes to allow the pDNA to enter the liposomes ...
-
bioRxiv - Bioengineering 2020Quote: ... We use the FreeStyle 293 expression system (Invitrogen) to express the fusion proteins ...
-
Intra-mitochondrial proteostasis is directly coupled to alpha-synuclein and Amyloid β 1-42 pathologybioRxiv - Neuroscience 2020Quote: Flp-InTM T-RExTM 293 cell line (Invitrogen), a derivative of HEK293 cells containing a stably integrated FRT site and a TetR repressor ...
-
bioRxiv - Immunology 2021Quote: ... Flp-In™-293 cells (Thermo Fisher Scientific) were transduced 3 times with lentivirus containing supernatant and selected with 1 μg/ml Puromycin (Invivogen ...
-
bioRxiv - Cancer Biology 2021Quote: T-REx™-293 (R71007, Thermo Fisher Scientific), GFP labelled human melanoma A375 wild type (WT ...
-
bioRxiv - Bioengineering 2022Quote: ... and Expi293F™ suspension 293 cells from ThermoFisher were transduced with the ACE2-Bite expressing VSVG pseudotyped lentiviruses with multiplicity of infection of 5 ...
-
bioRxiv - Immunology 2022Quote: ... before mixing with 80µl ExpiFectamine 293 Reagent (Invitrogen) diluted in 1.4 ml Opti-Plex Complexation Buffer (Invitrogen) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 900 mL of Freestyle 293-F cells (Invitrogen) were co-transfected with both vectors using polyethyleneimine and incubated at 37°C for 96 hours ...
-
bioRxiv - Immunology 2022Quote: ... using the ExpiFectamine 293 Transfection Kit (Gibco, A14524) according to manufacturer’s instructions ...