Labshake search
Citations for Thermo Fisher :
701 - 750 of 10000+ citations for TIM 3 Human HEK 293 Fc His since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: Cells (1-1.5×10^6) were incubated with FACS sample buffer (DPBS, 0.5% FBS) and human FC Block (Invitrogen) for 20 minutes on ice followed by incubation at 4°C for 30 minutes with the following - antibodies ...
-
bioRxiv - Biochemistry 2021Quote: ... labeled with 50 µL Goat anti-Human IgG Fc PE conjugate (ThermoFisher Scientific Invitrogen Catalog # 12-4998-82) diluted in 1.95 mL TBSF for 10 minutes covered on ice ...
-
bioRxiv - Immunology 2020Quote: ... and F(ab’)2-Goat anti-Human IgG-Fc secondary antibody conjugated with R-phycoerythrin (ThermoFisher Catalog # H10104). Labeled cells were acquired using a Thermo-Fisher Attune NxT flow cytometer and analyzed using Flowjo Software.
-
bioRxiv - Cell Biology 2023Quote: CEM were counted and resuspended at a concentration of 2-3 x 106 cells/mL in ice cold FACS buffer (PBS, 10% FCS, 2mM EDTA) containing 1.25 µL anti-human CD71 (0.625 µg/mL, OKT9, Invitrogen) for 1 h at 4°C then moved to 37°C and incubated for 1 h with or without 100 µM cytochalasin D (Merck) ...
-
bioRxiv - Microbiology 2024Quote: ... 0.2 μg/mL anti-human IgG Fc Highly Cross-Adsorbed Secondary Antibody (Cat: A18829, Thermo Fisher Scientific, USA) for 1 hour at 37°C ...
-
bioRxiv - Biochemistry 2022Quote: ... 20 μg of the plasmid was transfected into 20 mL of Expi293F cells at 3 × 106 cells mL-1 using ExpiFectamine 293 Transfection Kit (Thermo Fisher Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Expi293F cells were diluted to a density of 3 million cells per mL and transfected using ExpiFectamine 293 Transfection Kit (Thermo Fisher Scientific). Cells were incubated shaking at 130 rpm at 37°C and 8% CO2 ...
-
bioRxiv - Immunology 2022Quote: ... Cells grown to a density of 3 million per mL were transfected using the respective plasmids with the ExpiFectamine™ 293 Transfection Kit (ThermoFisher Scientific) and cultivated for 5 days ...
-
bioRxiv - Molecular Biology 2021Quote: HEK 293F cells (Thermo Fisher Scientific 12338026) and mAb 2F2 and 2E10.E9 hybridoma cell lines (BEI Resources MRA-184 and -185 ...
-
bioRxiv - Cell Biology 2021Quote: HEK 293FT cells (Thermo Fisher Scientific R70007) and B16-F1 mouse melanoma cells (ATCC CRL-6323 ...
-
bioRxiv - Cell Biology 2020Quote: HEK cells were cultured in DMEM (Gibco) with 10% heat-inactivated FBS (Gibco) ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK were cultured in EpiLife medium (Gibco), supplemented with 0.6 mM CaCl2 (Gibco) ...
-
bioRxiv - Neuroscience 2020Quote: ... suspension HEK-Expi293F™ cells (ThermoFisher Scientific) were cultured in Expi293™ expression media (Gibco ...
-
bioRxiv - Genomics 2023Quote: ... HEK 293FT cells were obtained from ThermoFisher Scientific (R70007 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The HEK-293T cells (Thermo-Fisher Scientific) were maintained in Dulbecco’s modified Eagle media (DMEM ...
-
bioRxiv - Immunology 2022Quote: HEK-293T was grown in DMEM (Gibco) supplemented with 10% FCS (Gibco) ...
-
bioRxiv - Genomics 2022Quote: ... HEK 293T was obtained from Life Technologies. K562 was authenticated by Short Tandem Repeat profiling (Genetica ...
-
bioRxiv - Immunology 2021Quote: ... The pcDNA 3.1+ vectors were then transfected individually into human embryonic kidney (HEK293T) suspension cells using ExpiFectamine 293 transfection reagent (ThermoFisher Scientific, Waltham, MA, USA) following manufacturer’s specifications ...
-
bioRxiv - Immunology 2023Quote: ... post-dose 3 and 6-months post-dose 3 using mouse anti-human IgG1 biotin (Thermo Fisher Scientific) and mouse anti-human IgG4 biotin (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: ... (gift from Drs. Steven Balk) and 293T (RRID:CVCL_0063) cells (gift from Dr. Tim Bender) were grown in DMEM (Invitrogen) with 10% heat-inactivated serum ...
-
bioRxiv - Systems Biology 2021Quote: ... Tn5 underwent a His-tag (Dynabeads His-Tag Isolation & Pulldown, Invitrogen, 10103D) clean-up according to the manufacturer’s protocol to remove unbound oligos before using.
-
bioRxiv - Microbiology 2021Quote: ... 10% HI FBS (Gibco), 1X ultraglutamine (Lonza) ...
-
bioRxiv - Microbiology 2021Quote: ... His (ThermoFisher, MA1-21315), FLAG (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... anti-His mAb (Invitrogen) and anti-GAPDH mAb (Life Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... HI FBS (2273356P, Gibco). HEPES (54457 ...
-
bioRxiv - Immunology 2020Quote: ... or anti-His (Invitrogen) for recombinant ZVrecE80 antigen in 0.1M carbonate buffer pH 9.6 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and His-tag (Invitrogen) were used ...
-
bioRxiv - Microbiology 2022Quote: ... anti-penta HIS (Invitrogen) and anti-HSP70 (26 ...
-
bioRxiv - Bioengineering 2024Quote: ... 10% HI-FBS (Gibco), 100 U ml−1 penicillin/100 μg ml−1 streptomycin (Gibco) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10% HI-FBS (Gibco), 1% penicillin/streptomycin (Gibco) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10% HI-FBS (Gibco), 1% penicillin/streptomycin (Gibco) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10% HI-FBS (Gibco), 1% penicillin/streptomycin (Gibco) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10% HI-FBS (Gibco), 1% penicillin/streptomycin (Gibco) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10% HI-FBS (Gibco), 1% penicillin/streptomycin (Gibco) ...
-
bioRxiv - Cell Biology 2024Quote: ... Human embryonic kidney (HEK) 293T cells were from ATCC (cat. #CRL-3216) and were cultured in high-glucose DMEM (Gibco, cat. #41966-052) supplemented with 10% FBS and 1% Penicillin-Streptomycin.
-
bioRxiv - Molecular Biology 2020Quote: ... supplemented with 10% FCS (FCS; Invitrogen; Thermo Fisher Scientific, Inc.). When the cultured cells reached 70-80% confluence at 37° C in a humidified 5 %CO2 incubator ...
-
bioRxiv - Molecular Biology 2020Quote: ... supplemented with 10% FCS (FCS; Invitrogen; Thermo Fisher Scientific, Inc.). When the cultured cells reached 70-80% confluence at 37° C in a humidified 5 %CO2 incubator ...
-
bioRxiv - Immunology 2022Quote: ... anti-Human CD223(LAG-3) antibody (Invitrogen, eBioscience,, Percp-efluor™710), anti-Human CD45RA antibody (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... were transfected with human myosin VI siRNA duplex (5′GGUUUAGGUGUUAAUGAAGtt-3′) (Ambion) or AllStars Negative Control siRNA duplex (Qiagen ...
-
bioRxiv - Molecular Biology 2020Quote: P2 virus was added to 2.0 million per ml of Freestyle™ 293-F Cells (Themofisher Scientific) in Gibco FreeStyle 293 Expression Medium (Invitrogen) at a final volume of 10% at 37 °C and 5% CO2 ...
-
bioRxiv - Immunology 2024Quote: ... The plasmids were co-transfected into FreeStyle 293 F cells that were cultured in FreeStyle 293 Expression Media (Gibco #12338018) using Fectopro (Polyplus ...
-
bioRxiv - Cancer Biology 2024Quote: ... 293-GP (for retrovirus production) or 293-T (for lentivirus production) were transfected with these plasmids in OptiMEM medium (Gibco) using PEIpro transfection reagent (Polyplus ...
-
bioRxiv - Immunology 2020Quote: ... and reverse primer ENVN (5’ - TGCCAATCAGGGAAAAAGCCTTGTGTG - 3’. The envelope amplicons were purified, and ligated into pcDNA3.1D/V5-His-TOPO vector (Invitrogen). Chimeric envelope pseudoviruses were generated by swapping the V1V2 ...
-
bioRxiv - Immunology 2020Quote: ... were coated at room temperature for 3 hours with 1 μg/mL PolyRab anti-His antibody (ThermoFisher, PA1-983B), followed by overnight blocking with blocking buffer containing 1x PBS ...
-
bioRxiv - Biophysics 2023Quote: ... and from the 3’-terminus by the 10×His-tag nucleotide sequence and inserted into a pFastBac1 vector (Invitrogen) via the BamHI(5’ ...
-
bioRxiv - Microbiology 2023Quote: ... we initially digested the pNL4-3 plasmid with EcoRI and XhoI and subcloned this fragment into pcDNA3.1/myc-His A (Invitrogen). To generate pcDNA3.1 NL4-3 Env TMTR ...
-
bioRxiv - Biophysics 2023Quote: ... and from the 3’-terminus by 10×His-tag nucleotide sequence and inserted into the pFastBac1 vector (Invitrogen, USA) via the BamHI(5’ ...
-
bioRxiv - Bioengineering 2020Quote: ... T cells were cultured in RPMI-1640 supplemented with 10% HI-FBS and fed with recombinant human IL-2 (ThermoFisher) and IL-15 (Miltenyi ...
-
bioRxiv - Immunology 2021Quote: ... The expression vectors encoding mHVEM (Q39-Q206) fused with human IgG1 and a subsequent hexa-His tag sequences were transfected into Expi293 (Gibco) cells using ExpiFectamine 293 transfection kit (Gibco ...
-
bioRxiv - Immunology 2021Quote: ... The DNA sequences encoding a protein biologic composed of mHVEM residues (Q39- Q206) followed by human IgG1 and a subsequent hexa-His tag sequences were cloned into pcDNA 3.3 vector (Life technologies) using In-fusion HD cloning enzyme premix (Clontech) ...