Labshake search
Citations for Thermo Fisher :
6301 - 6350 of 10000+ citations for 5 Alpha dihydroprogesterone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Cultured neurons were maintained in a 5% CO2 humidified incubator in Neurobasal-A medium (Invitrogen) containing 1.25% fetal bovine serum (FBS ...
-
bioRxiv - Genomics 2021Quote: ... Erythrocytes were lysed by treatment with 3-5 mL ACK lysing buffer (Gibco, Cat#A1049201) for 5 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... BMSCs were cultured at 37°C and 5% CO2 with DMEM/F12 medium (Gibco, USA) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2021Quote: ... London) were transiently transfected with the following antisense oligos: ROD1 (5′ GGAAUGAUAUUGAGCUGCUAACAAA 3′; ThermoFisher Scientific), TACC3 (5’ GAGCGGACCUGUAAAACUA 3’ ...
-
bioRxiv - Immunology 2022Quote: ... 5 μL of chromatin was measured using the Qubit dsDNA HS Assay Kit (Invitrogen, Q32851).
-
bioRxiv - Microbiology 2022Quote: ... 5 µL of fixed sample were stained with 195 µL SYBR gold (Invitrogen, Paisley, UK) prepared in Tris-EDTA buffer as instructed by the manufacturer (5 μL SYBR gold in 50 mL Tris-EDTA) ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 stocks of rRRV-HuNoV-VP1 with Trizol Reagent (Thermo Fisher Scientific, cat. #15596018) according to the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2022Quote: ... Animals were injected intraperitoneally with 40 mg/kg EdU (5-ethynyl-2’-deoxyuridine; Invitrogen, E10187) before the session ...
-
Activation of innate immune cGAS-STING pathway contributes to Alzheimer’s pathogenesis in 5×FAD micebioRxiv - Neuroscience 2022Quote: ... Slides were counterstained with 5 μg/mL 4’,6-diamidino-2-phenylindole (DAPI; ThermoFisher Scientific) for 10 min at room temperature and washed with 1 × PBST (0.2% Triton-X 100 ...
-
bioRxiv - Developmental Biology 2022Quote: ... The isolated kidneys were placed in 5 ml Hanks and 25 ul LysoTracker Red (Invitrogen) and cultured at 37° C for 30 minutes ...
-
bioRxiv - Physiology 2022Quote: ... Reactions were run in duplicate on a Quantstudio 5 384-well PCR machine (Thermo Fisher Scientific Life Sciences ...
-
bioRxiv - Cell Biology 2022Quote: ... boiled 5 min at 95 °C in 80 μl NuPAGE LDS Sample Buffer (Invitrogen, #NP0007) and dithiothreitol ...
-
bioRxiv - Cancer Biology 2022Quote: ... To quantify mitochondrial ROS cells were incubated with 5 μM MitoSOX Red (Thermo Fisher, M36008). After 30 minutes of staining ...
-
bioRxiv - Biochemistry 2022Quote: ... 5 μL of sample were injected by a Vanquish Split Sampler HT autosampler (Thermo Scientific), while the autosampler temperature was kept at 4 °C ...
-
bioRxiv - Biophysics 2022Quote: ... 5 µL of chromatin was measured using the Qubit dsDNA HS Assay Kit (Invitrogen, Q32851). To ensure similar chromatin concentrations and match IP conditions ...
-
bioRxiv - Cell Biology 2022Quote: ... These cells were incubated at 37°C in 5% CO2 and passaged with trypsin (Gibco) 2–3 times per week to ensure that they never reached confluency.
-
bioRxiv - Cell Biology 2022Quote: ... These cells were incubated at 37°C in 5% CO2 and passaged with trypsin (Gibco) every 72 hours to ensure that they never reached confluency.
-
bioRxiv - Cancer Biology 2022Quote: ... All antibodies used were dissolved in 5% albumine bovine fraction V (Thermo Scientific, pH 7.0) in TBS-T.
-
bioRxiv - Genomics 2022Quote: ... media was changed to 1:1 KSR: N2B media with puromycin (5 ug/ml, Gibco). Puromycin was maintained in the media throughout the differentiation ...
-
bioRxiv - Immunology 2022Quote: ... and incubated overnight at 37 °C and 5% CO2 in R10 without phenol red (Gibco). The following day ...
-
bioRxiv - Developmental Biology 2022Quote: ... The right ventricle was perfused with 5-10 mL of cold PBS (Gibco, 10010-023) to clear blood from the lungs ...
-
bioRxiv - Developmental Biology 2022Quote: ... Primed hPSCs were cultured on plates pre-treated with 5 μg/ml Vitronectin (ThermoFisher Scientific) in mTeSR Plus medium (STEMCELL Technologies ...
-
Antiviral roles of interferon regulatory factor (IRF)-1, 3 and 7 against human coronavirus infectionbioRxiv - Microbiology 2022Quote: ... cells were transfected with 5 pmol siRNA oligoes using Lipofectamine RNAiMAX Transfection Reagent (Life Technologies) and 24 hours later challenged with or without 229E or OC43 ...
-
bioRxiv - Microbiology 2022Quote: ... The cells were released from the flask using 5 mL of 0.25% trypsin-EDTA (Gibco), followed by washing three times with PBS (Gibco).
-
bioRxiv - Immunology 2022Quote: ... These cocultures proceeded for 5 hours in the presence of monensin (Invitrogen 00-4505-51) and PE labeled CD107a antibody (1:100 ...
-
bioRxiv - Microbiology 2022Quote: ... for 5 min followed by staining with an anti-human Alexa FluorTM 555 antibody (ThermoFisher). Coverslips were mounted on glass slides using ProLongTM Gold Antifade Mountant containing DAPI (ThermoFisher ...
-
bioRxiv - Systems Biology 2022Quote: ... and ground through 0.45uM filters into 5 mL of media (DMEM (Gibco/Thermo-Fisher, 12430112) with 10% FBS (Hyclone/Thermo-Fisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... we added fresh medium with 5% FBS and performed transfection with Lipofectamine 3000 (Thermo Fisher) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... labeled at its 5’-end with [32P]-γ-ATP using T4 Polynucleotide kinase (Thermo Fisher) according to the supplier instructions.
-
bioRxiv - Neuroscience 2022Quote: ... for 5 min and loaded onto 4%–12% Nupage Bis-Tris gels (Novex/Life Technologies). Proteins were transferred using the iBlot2 (Life Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were blocked for 5 minutes in SuperBlock™ (TBS) Blocking Buffer (ThermoFisher Scientific), followed by incubation with antibodies diluted in SuperBlock™ (TBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... or ALS-associated Ruby-tagged sequences of DnaJC7 using 5 μL of Lipofectamine 2000 (Gibco) transfection reagent in OptiMEM (Gibco ...
-
bioRxiv - Physiology 2022Quote: ... Quantitative PCR with reverse transcription (qPCR) was performed on a QuantStudio 5 thermocycler (ThermoFisher Scientific) with the following conditions ...
-
bioRxiv - Neuroscience 2022Quote: ... Animals were injected intraperitoneally with 40 mg/kg EdU (5- ethynyl-2’-deoxyuridine; Invitrogen, E10187) before and after the session ...
-
bioRxiv - Physiology 2022Quote: ... 5 mg of Dynabeads were washed in the C1 buffer (Thermo Fisher Scientific, Waltham, MA) by vortexing and placed on the magnet column for 1 minute ...
-
bioRxiv - Physiology 2022Quote: ... Fetal liver cells were resuspended in cold DMEM with 5% fetal bovine serum (FBS, Gibco), filtered through a 70-µm filter (BD) ...
-
bioRxiv - Physiology 2022Quote: ... and 5% sucrose supplemented with 2x protease inhibitors (Halt™ Protease Inhibitor Cocktail, Thermo Scientific) and 0.25% NP-40 prepared in ddH2O (pH =7.2) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... live cells were incubated with 5 μM CellROX (cat. nr.: C10422, ThermoFisher Scientific, Massachusetts, USA) by adding 10 μl of a 55 μM CellROX solution in treatment medium directly to the well ...
-
bioRxiv - Neuroscience 2022Quote: ... the cells were cultured on vitronectin-coated plates (5 μg/mL, Thermo Fisher Scientific, A14700) in Essential 8 medium (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... astrocytes and human iMGLs on PDL-coated round 5 mm glass coverslips (Thermo Scientific Menzel) at density of 7000-10000 cells/coverslip ...
-
bioRxiv - Molecular Biology 2022Quote: ... then a final extension of 72°C for 5 mins by using ProFlex (Applied Biosystems) PCR machine ...
-
bioRxiv - Microbiology 2022Quote: ... and rabbit anti-TLR-5 polyclonal antibody (10 µg/ml, 36-3900, Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2022Quote: ... Membranes were washed with PBS then blocked with 5% normal goat serum (Thermo Fisher Scientific) at RT for 1h ...
-
bioRxiv - Molecular Biology 2022Quote: ... the skin and wound tissues were incubated in dispase II (5 U/mL, ThermoFisher Scientific) at 4°C overnight ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were harvested after 5 min treatment with 0.25% trypsin-EDTA (#25200-056 from Gibco) supplemented with 1 mM pyruvate (Tryp-EDTA-Pyr) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... were cultured at 37°C in a 5% CO2 incubator on Geltrex (Thermo Fisher Scientific) in DMEM F12 (Fisher scientific ...
-
bioRxiv - Neuroscience 2022Quote: Mice were injected with 100 mg/kg of 5-ethynyl-2’-deoxyuridine (EdU; Invitrogen #E10187) by intraperitoneal injection for 5 consecutive days ...
-
bioRxiv - Immunology 2022Quote: ... denatured at 95 °C for 5 min and loaded on a 10 % acrylamide gel (Invitrogen) for sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) ...
-
bioRxiv - Plant Biology 2022Quote: ... Root sections were also stained with basic fuchsin (Fisher scientific Cat no 632-99-5). 1 cm segments from the root tip were embedded in 3% agarose and were sectioned at 150-200 μM using a vibratome (Leica VT1000 S) ...
-
bioRxiv - Physiology 2022Quote: ... 5 mM β-mercaptoethanol) supplemented with EDTA-free phosphatase and protease inhibitor cocktail (Life technologies) and lysed by Dounce homogenization (20 strokes) ...