Labshake search
Citations for Thermo Fisher :
6401 - 6450 of 10000+ citations for 5 Alpha dihydroprogesterone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Tuning non-linear mechanics in collagen hydrogels modulates cellular morphotypes in three dimensionsbioRxiv - Biophysics 2024Quote: ... and 5 mL Minimum Essential Medium Non-Essential Amino Acids (MEM NEAA, 100 X, Gibco). 1205 Lu endogenously labelled for meGFP-α-Tubulin (CRISP ...
-
bioRxiv - Biophysics 2024Quote: ... 5 μg·ml-1 blasticidin (MilliporeSigma, 203350) and 100 μg·ml-1 zeocin (Thermo Scientific Chemicals, J67140XF). Transfected cells were maintained in the complete culture medium ...
-
bioRxiv - Cell Biology 2024Quote: ... Two mg of 5-ethynyl uridine (EU, Click-iT™ Nascent RNA Capture Kit, Invitrogen) per mouse were injected at 24 days post-partum (dpp ...
-
bioRxiv - Microbiology 2023Quote: ... and reactions were performed on the QuantStudio 5 Real-Time PCR systems (Thermo Fisher Scientific). Viral E RNA copies were determined as described previously15,16 ...
-
bioRxiv - Biophysics 2024Quote: ... samples were blocked with a solution of 5 v/v % Fetal Bovine Serum (FBS, Gibco) and 1 w/v % Bovine Serum Albumin (BSA ...
-
bioRxiv - Developmental Biology 2024Quote: ... Probe fluorescence was measured with a QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific) running the following cycling program ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was filtered and incubated with 5 mL of Ni-NTA beads (Thermo Scientific) for 1 h ...
-
bioRxiv - Microbiology 2023Quote: ... and incubated in blocking buffer (2,8 mM KH2PO4, 7,2 mM K2HPO4, 5% goat serum [Gibco, Billings ...
-
bioRxiv - Immunology 2023Quote: Cells were loaded with 5 μg/mL Indo-1 AM per manufacturer’s instructions (Life Technologies) and stained with lineage markers B220 ...
-
bioRxiv - Neuroscience 2023Quote: ... Eyes were embedded in Richard-Allan Scientific Neg-5 Frozen Section Medium (Thermo Fisher Scientific) and sectioned at 16 μm ...
-
bioRxiv - Microbiology 2023Quote: ... seeded at 5 x 106 cells/mL in black polystyrene Nunc 96 well plates (Thermofisher), were cultured in RPMI supplemented with 10% heat inactivated fetal calf serum (FCS) ...
-
bioRxiv - Plant Biology 2023Quote: ... a 5 mg/mL stock in EtOH (Ethanol 99.5%, HPLC grade, J.T. Baker /Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... For cryosections we used 0.5% Triton X-100 with 5% Donkey Serum (Thermo Fisher Scientific) in PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... Reduction of proteins was achieved with 5 mM Tris(2-carboxyethyl)phosphine hydrochloride (Thermo Fisher) for 30 min and samples were subsequently alkylated in 10 mM iodoacetamide (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... 5×105 EPCAM+ cells in 200 μl CMM medium based on DMEM/F12 (Gibco, 11320033) supplemented with 1 mM L-glutamine (Life technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... digestion for 3 to 5 min at 37 °C and washed with Neurobasal medium (Invitrogen) supplemented with 2% B-27 (Invitrogen) ...
-
bioRxiv - Immunology 2023Quote: ... B-cells were cultured at 37 °C and 5% CO2 in 1640 RPMI (Life technologies) supplemented with 10% FCS (Biowest) ...
-
bioRxiv - Biochemistry 2023Quote: ... the coverslip was mounted on a glass slide using 5 μL SlowFade (Invitrogen Life Technologies) and the edges sealed with fingernail polish ...
-
bioRxiv - Biochemistry 2023Quote: ... the coverslip was mounted on a glass slide using 5 μL SlowFade (Invitrogen Life Technologies) and the edges sealed with fingernail polish ...
-
bioRxiv - Bioengineering 2022Quote: ... Real time qPCR was performed using the QuantStudio 5 Real-Time PCR system (Applied Biosystems) using a total reaction volume of 20 μL ...
-
bioRxiv - Bioengineering 2022Quote: ... 100Å) with a C18 nano Viper trap-column (0.3 mm ×5 mm, Thermo Fisher Scientific) was used for peptide elution and separation ...
-
bioRxiv - Molecular Biology 2023Quote: ... Real-time PCR was performed using the QuantStudio 5 Real-Time PCR System (Applied Biosystems) and the THUNDERBIRD NEXT SYBR qPCR Mix (TOYOBO) ...
-
bioRxiv - Molecular Biology 2023Quote: MCF10A cells were cultured in DMEM/F12 (Nacalai Tesque) supplemented with 5% horse serum (Gibco), 20 ng/ml EGF (PeproTech) ...
-
bioRxiv - Microbiology 2023Quote: ... Nuclei were counterstained by Hoechst 33342 (Thermo Fisher Scientific, 2 μg/mL, 5 min, RT), and slides were mounted in ProLong Gold antifade mountant (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2022Quote: ... BM cells were incubated with MitoSOX Red (5 μM, Thermo Fisher Scientific, Cat. No. M36008) at 37 °C in PBS and then with appropriate BM progenitor or monocyte makers plus viability dye for 20 min at 4 °C ...
-
bioRxiv - Microbiology 2023Quote: ... MRC-5 and HEK293-FT cells were grown in DMEM with GlutaMAX (Thermo Fisher # 10566016). CHO-K1 ...
-
bioRxiv - Microbiology 2022Quote: ... Biotin was detected using a streptavidin-conjugated AlexaFluor488 (5 μg/ml; Thermo Fisher Scientific; S11223). Virus and mock inoculations in non-enzymatic-treated cells were included as positive and negative infection controls ...
-
bioRxiv - Molecular Biology 2023Quote: ... and aqueous phase was precipitated with 1 volume of isopropanol and 5 ug Glycogen (Invitrogen) at -80 °C for 1 hour ...
-
bioRxiv - Molecular Biology 2023Quote: ... or a combination of DNase I and 5 µg of RNase A (Thermo Scientific; EN0531). For the untreated BNE profile ...
-
bioRxiv - Immunology 2023Quote: ... The isolated cells were fluorescently labelled with 5 μM CellTrace Violet (C34571, Thermo Fisher Scientific) in PBS for 8 min at 37° C and washed twice in R10 media ...
-
bioRxiv - Biochemistry 2023Quote: In vitro transcribed RNA was 5’ dephosphorylated using FastAP™ thermosensitive alkaline phosphatase (Thermo Scientific) according to manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2023Quote: ... with 5% FBS or at P7-8 in ice-cold Hibernate-A Medium (ThermoFisher, A1247501) with 10% FBS and B-27 Supplement (ThermoFisher ...
-
bioRxiv - Genomics 2023Quote: ... then resuspend in 5 mL blocking buffer with goat-anti-rabbit-647 (ThermoFisher A-21245) at 1:5,000 and DAPI at 1:100,000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Sections were cut at 5 μm thickness and collected on Superfrost- plus slides (Fisher Scientific). E17.5 limbs were decalcified with EDTA at 4°C overnight before paraffin embedding.
-
bioRxiv - Immunology 2023Quote: ... or in 20 mL TBE + 5 uL of SYBR Green DNA Gel Stain (ThermoFisher Scientific). Gels were imaged on the BioRad Gel Doc imaging system.
-
bioRxiv - Biophysics 2023Quote: HeLa TDS cells were cultured at 37 °C and 5% CO2 in DMEM (Gibco, Invitrogen) supplemented with 10% FBS (Life Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µg of RNA was precleared with 25 µl of Protein G Dynabeads (Invitrogen, 10003D) for 30 min at 4 °C ...
-
bioRxiv - Microbiology 2023Quote: ... qRT-PCR was performed using the QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific), and the Ct values of Zcchc3 were normalized to the mean values obtained using ACTB as a housekeeping gene (ΔΔCt method).
-
bioRxiv - Molecular Biology 2023Quote: ... after a short incubation (30 minutes) with EU (5-ethynyl uridine, Thermo Fisher Scientific, E10342) and in the presence or absence of a MYC inhibitor (64 µM ...
-
bioRxiv - Immunology 2023Quote: ... 5% CO2 in CTS™ OpTmizer™ T-Cell Expansion SFM (ThermoFisher Scientific Cat# A1048501).
-
bioRxiv - Plant Biology 2023Quote: ... CP-R: 5’GGGGACCACTTTGTACAAGAAAGCTGGG TCCTGCACAGAACCTACTCC3’) and subcloned into the Gateway entry vector pDONR 221 (Invitrogen) by BP reaction and finally recombined into the destination vector pEarleyGate 201-nYFP and pEarleyGate 202-cYFP vector (Dai et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... The neurons were then washed 3 times for 5 minutes with 1X DPBS (14080055, Gibco) containing 0.1% Tween ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Bile canaliculi were observed with a live staining technique using 5-chloromethylfluorescein diacetate (CMFDA, Invitrogen). Immunofluorescent and brightfield images were taken using an inverted epifluorescence microscope (Zeiss).
-
bioRxiv - Cancer Biology 2023Quote: ... and NBL-W-S were grown at 5% CO2 in RPMI 1640 medium (Life Technologies) supplemented with 10% heat-inactivated FBS ...
-
bioRxiv - Bioengineering 2023Quote: ... which was immediately neutralized by adding 5 μl aliquots of 5M NaOH (Fisher Scientific, MA). Stem Cell Qualified ECM Gel (CC131-5ML ...
-
bioRxiv - Bioengineering 2023Quote: ... qRT-PCR plates were run using the QuantStudio 5 Real-Time PCR system (Applied Biosystems) with a total reaction volume of 20 µL ...
-
bioRxiv - Biophysics 2023Quote: ... the tissue was incubated for 5 min with 1 µM TO-PRO-3 iodide (Invitrogen, Life Technologies Corporation ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were subsequently incubated with the blocking solution (5% Skim Milk Powder (10651135, Fisher Scientific) added to tris-buffered saline (TBS ...
-
bioRxiv - Microbiology 2023Quote: ... 200 µl clarified lysate were combined with 5 µl RNase I (10 U/µl, Invitrogen). Reactions were incubated at RT for 45 min with shaking ...
-
bioRxiv - Molecular Biology 2023Quote: ... the cells were cultured in air with 5% CO2 at +37°C with DMEM (Gibco) containing 10% fetal bovine serum (BioWest) ...