Labshake search
Citations for Thermo Fisher :
6151 - 6200 of 10000+ citations for Human UFL1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Recombinant human IgG1 mAbs were produced by co-transfection of Freestyle 293-F suspension cells (Thermo Fisher Scientific) as previously described 57 and purified by affinity chromatography using protein G sepharose 4 fast flow beads (GE Healthcare).
-
bioRxiv - Microbiology 2019Quote: Human HaCaT epithelial keratinocytes and Vero cells were propagated in Dulbecco’s modified Eagle’s medium (DMEM; Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cancer Biology 2021Quote: The siRNA duplex (21 nucleotides) against human cath-D siRNA (ID 4180) was purchased from Ambion (Austin, TX), and the firefly luciferase (Luc ...
-
bioRxiv - Cell Biology 2021Quote: Human epithelial colon adenocarcinoma, Caco2, cells (ACC 169, DSMZ, Leipzig, Germany) were grown in DMEM/F-12 (Gibco, Thermo Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA interference was performed using 10 pmol of duplexes targeting human MLKL (GCAACGCAUGCCUGUUUCACCCAUA, Stealth siRNA from Life Technologies) or non-silencing control duplexes (low-GC 12935111 ...
-
bioRxiv - Biophysics 2021Quote: The pTWIN1 vector containing human Httex1 fused to His6-SUMO was ordered from GeneArt Gene Synthesis (Life Technologies); E ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were then stained with 5 µL FITC anti-human DR4 (Thermo Fisher Scientific, Clone DR-4-02) for 30 min at 4°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... The control human IgG antibody for in vitro and in vivo studies was from Invitrogen (Carlsbad, CA, USA).
-
bioRxiv - Microbiology 2022Quote: ... 2011) were grown in human foreskin fibroblasts (HFF) monolayers in Dulbecco’s modified Eagle’s medium (DMEM) with GlutaMAX (Gibco) supplemented with 10% Nu-Serum (Gibco) ...
-
bioRxiv - Neuroscience 2022Quote: ... The human NPCs sourced from Polymenidou group (UZH) were plated in media supplemented with DMEM/F12 (Thermo Fisher), 0.5X B27-supplement (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2022Quote: The human colon adenocarcinoma cell lines LS174T (derived from Caucasian colon adenocarcinoma) maintained in RPMI 1640 medium (Gibco) supplemented with 10% FBS (BI ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant human IgG1 mAbs were produced by co-transfection of Freestyle 293-F suspension cells (Thermo Fisher Scientific) as previously described 48 and purified by affinity chromatography using protein G sepharose 4 fast flow beads (GE Healthcare).
-
bioRxiv - Bioengineering 2022Quote: ... the cells were incubated with primary antibodies such as rabbit anti-human ZO-1 IgG (Thermo Fisher Scientific) and mouse anti-human albumin IgG (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... was premised on a commercial human RNaseP primer/probe set (443328, Applied Biosystems, Thermo Fisher Scientific, Waltham, MA).
-
bioRxiv - Microbiology 2022Quote: ... was premised on a commercial human RNaseP primer/probe set (443328, Applied Biosystems, Thermo Fisher Scientific, Waltham, MA).
-
bioRxiv - Microbiology 2022Quote: THP-1 cells (1.0 × 106) were transfected with human siRNA (10 nM) using Lipofectamine 3000 (Invitrogen, Waltham, MA). All siRNAs were ON-TARGETplus SMARTpool (Dharmacon ...
-
bioRxiv - Microbiology 2022Quote: ... supplemented with human recombinant epidermal growth factor (rEGF) and bovine pituitary extract (BPE) plus 2% penicillin-streptomycin (Gibco) at 37°C in 5% CO2 ...
-
bioRxiv - Microbiology 2022Quote: Human embryonic kidney cells (293T; ATCC; ATCC CRL-11268) were maintained in Dulbecco’s modified Eagle’s medium (DMEM; Gibco), 10% fetal calf serum (FCS) ...
-
bioRxiv - Biophysics 2022Quote: ... and 1 μg/ml Recombinant Human Fibroblast growth Factor-basic (FGFb) (Catalog # 13256-029 Gibco, Thermo Fisher Scientific) at 37°C with 5% CO2 ...
-
bioRxiv - Biophysics 2022Quote: ... and 1 μg/ml Recombinant Human Fibroblast growth Factor-basic (FGFb) (Catalog # 13256-029 Gibco, Thermo Fisher Scientific) at 37°C with 5% CO2 ...
-
bioRxiv - Bioengineering 2022Quote: ... Human CD8+ T cells were negatively isolated from PBMC and labeled with 5μM of Cell Trace Violet (Invitrogen) according to manufacturer’s specifications ...
-
bioRxiv - Microbiology 2022Quote: Human A549 cells (ATCC CCL-185) and its derivatives were cultured in RPMI 1640 (Gibco catalog no. 11875) supplemented with 10% FBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... CD8 and CD4 T cells were activated and expanded with Dynabeads Human T-Activator CD3/CD28 (Thermo Fisher) per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... EGF-Cy3B was generated using NHS-Cy3B (Cytiva, Marlborough, MA) conjugated to recombinant human EGF (Gibco, ThermoFisher Scientific), using 1:1 labeling stoichiometry as described previously 60 ...
-
bioRxiv - Cell Biology 2022Quote: ... EGF-Cy3B was generated using NHS-Cy3B (Cytiva, Marlborough, MA) conjugated to recombinant human EGF (Gibco, ThermoFisher Scientific), using 1:1 labeling stoichiometry as described previously 60 ...
-
bioRxiv - Cell Biology 2022Quote: ... at 37 °C and 5% CO2 in EMEM (ATCC) supplemented with 0.01 mg/mL human recombinant insulin (Gibco) and 10% (vol/vol ...
-
bioRxiv - Cell Biology 2022Quote: ... Primary chondrocytes were isolated from the articular cartilage of human joints and expanded in DMEM (high glucose; Gibco) supplemented with 10% FBS (Gibco) ...
-
bioRxiv - Cell Biology 2022Quote: ... A codon-optimized vector expressing human spatacsin was generated (Baseclear, Leiden, Netherlands) in a gateway compatible system (Thermofisher). The cDNA was transferred by LR clonase into the pDest-47 vector (Thermofisher) ...
-
bioRxiv - Biochemistry 2021Quote: ... labeled with 50 µL Goat anti-Human IgG Fc PE conjugate (ThermoFisher Scientific Invitrogen Catalog # 12-4998-82) diluted in 1.95 mL TBSF for 10 minutes covered on ice ...
-
bioRxiv - Microbiology 2020Quote: Cytokine levels in sinus wash were quantified using a Luminex 35-Plex Human Panel (Invitrogen, Frederick, MD, USA).
-
bioRxiv - Neuroscience 2021Quote: ... human DRGs immediately were cut into 1-2 mm pieces and stored in RNA-later (ThermoFisher, Cat# AM7021). For ISH ...
-
bioRxiv - Microbiology 2021Quote: Human A549 type II alveolar epithelial cells (ATCC CL-185) were grown in Minimum Essential Medium (MEM, Gibco) supplemented with 8% heat-inactivated newborn calf serum (HI-NBCS ...
-
bioRxiv - Neuroscience 2021Quote: ... The primary antibody was incubated overnight at 4°C [human Pax6 polyclonal antibody (1:100, Thermo Fisher Scientific)] ...
-
bioRxiv - Microbiology 2020Quote: ... 100 units/ml Penicillin and 100μg/ml Streptomycin) supplemented with 12.5uL/mL of dynabeads human T-activator CD3/CD28 (Invitrogen), 2μg/mL anti-human IL-12 (PeproTech) ...
-
bioRxiv - Immunology 2020Quote: Allogenic CD8+ T-cells were isolated by negative selection using Dynabeads Untouched Human CD8 T Cells Kit (Invitrogen), labeled with carboxyfluorescein succinimidyl ester (CFSE ...
-
bioRxiv - Microbiology 2021Quote: ... HEK-293T overexpressing the human ACE2 were kindly provided by Integral Molecular Company and maintained in DMEM (Invitrogen) with 10% fetal bovine serum ...
-
bioRxiv - Biochemistry 2021Quote: ... Differentiation of H9 ES cells was induced by exchanging human ES cell growth medium with DMEM/F12 (Gibco) containing 2 mM L-glutamine ...
-
bioRxiv - Cell Biology 2022Quote: Human proteins (LIS1-SNAP, or motor domains) were expressed and purified from insect cells (ExpiSf9 cells; Life Technologies) as previously described with minor modifications3,7,20,69 ...
-
bioRxiv - Microbiology 2022Quote: Toxoplasma gondii tachyzoites were amplified in human foreskin fibroblasts (HFFs, ATCC) in Dulbecco’s Modified Eagle’s Medium (DMEM, Gibco) supplemented with 5% of Fetal Bovine Serum (FCS ...
-
bioRxiv - Physiology 2022Quote: Total RNA from human liver biopsies (10-20 mg) was extracted using Trizol extraction (Life Technologies, Carlsbad, CA) followed by a purification step using the GeneJET RNA Purification kit (Thermo Scientific) ...
-
bioRxiv - Immunology 2022Quote: Human bladder carcinoma 5637 cells (ATCC, HTB-9) were grown in RPMI-1640 media (GIBCO, cat.no. 21875-034) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Biochemistry 2022Quote: Human embryonic kidney cells (HEK293T, ATCC, Cat#: CRL-3216) cells were cultured in Dulbecco’s modified Eagle’s medium (Gibco, Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: Fresh-frozen human postmortem brain tissues were sectioned at 10 μm onto Superfrost Plus glass slides (Fisher Scientific). Sections were dried for 10 minutes at -20°C and then vacuum sealed in plastic slide boxes and stored at -80°C until use ...
-
bioRxiv - Immunology 2019Quote: ... Dynabeads Human T-Activator CD3/CD28 for T-cell expansion and Activation kit (1132D) were purchased from Thermofisher Scientific ...
-
bioRxiv - Developmental Biology 2019Quote: Human induced pluripotent stem cells (iPS line WTSIi008-A, EBiSC, UK) were cultured in E8 medium (Life technologies) on Geltrex coating (Life technologies ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and human normal fibroblast cell line HS68 (ATCC #: CRL-1635) were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with 10% (v/v ...
-
bioRxiv - Developmental Biology 2020Quote: ... total RNA were extracted then reverse transcribed using the Ion AmpliSeq Transcriptome Human Gene Expression kit (Thermofisher Scientific). The cDNA libraries were amplified and barcoded using Ion AmpliSeq Transcriptome Human Gene Expression core panel and Ion Xpress Barcode Adapter (Thermofisher Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... at 4% haematocrit in supplemented RPMI media (RPMI-HEPES, 0.2% NaHC03, 5% heat-inactivated human serum [Australian Red Cross], 0.25% AlbumaxII [GIBCO] ...
-
bioRxiv - Genomics 2019Quote: ... Primary antibodies (anti-human CD47-APC; clone CC2C6, BioLegend, Cat. #323123/4, RRID: AB_2716202/3; and clone B6H12.2, ThermoFisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Human MSCs at passage 2 were maintained in growth media consisted of alpha-MEM (Life Technologies, 32561--037) supplemented with 17% FBS (Sigma-Aldrich ...