Labshake search
Citations for Thermo Fisher :
5751 - 5800 of 10000+ citations for 6H 1 3 Dioxolo 4 5 g 1 benzopyran 6 one 7 8 dihydro since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... counted and 1×105 viable cells were used to produce cytospin slides (Thermo Shandon Cytospin 3, Thermo Scientific). Cytospin slides were fixed in 4% PFA ...
-
bioRxiv - Immunology 2020Quote: ... Chambers were rinsed three times with PBS after which RPMI-HSA containing 1 µM To-pro-3 (Thermofisher) was added ...
-
bioRxiv - Neuroscience 2022Quote: ... B27 supplement in the 3:1-DMEM/F12-medium was replaced with 1x N2 supplement (Gibco, #17502-48), 10% (v/v ...
-
bioRxiv - Immunology 2021Quote: 1 × 106 TBK1.1 spores were inoculated into a flask containing 3 ml RPMI 1640 medium with HEPES (Gibco) containing 2% glucose in a 37°C shaker at 100 rpm in triplicate ...
-
bioRxiv - Cell Biology 2022Quote: ... the cells were then stained with secondary antibodies diluted 1:500 in 3% BSA and DAPI (Invitrogen D3571) for 1 h at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... ONs were incubated in PTwH/3% Goat serum + secondary antibody (anti-rat AlexaFluor 555 (1:500, Molecular probes), and anti-chicken AlexaFluor 633 (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 μl of diluted cDNA (1:20) was used with Fast SyBr green qPCR master mix (Life Technologies) for the PCR reaction ...
-
bioRxiv - Cell Biology 2022Quote: ... worms were transferred to bacteria-seeded plates containing 1 mM indole-3-acetic acid (Acros Organics, Cat #122160250) and incubated for the indicated time periods before analysis.
-
bioRxiv - Bioengineering 2024Quote: ... a ‘shim’ photomask reflecting the geometry of a standard 1’’ x 3’’ microscope slide (12-559-A3, ThermoFisher) was printed at 20,000 d.p.i (CAD/Art Services ...
-
bioRxiv - Biophysics 2024Quote: ... Calibration involved introducing 3 μL of a 1:100 v/v pre-diluted NativeMark standard (LC0725, Thermo Scientific) to an acquisition well ...
-
bioRxiv - Neuroscience 2024Quote: We labeled 500 µL of 1 mM lipid structures with different contents by adding 10 µL of 1 mM DiI Stain (1,1’-dioctadecyl-3,3,3’,3’ tetramethylindocarbocyanine perchlorate) (Fisher Scientific) or 10 µL of 1 mg/mL Invitrogen™ DiD oil (DiD ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Ligations were performed at a vector: insert mass ratio of 3:1 using T4 DNA ligase (Thermo Scientific) at 16 °C overnight ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.5 million SK-BR-3 and 1 million hPMBCs were stained with CellTracker™ Green CMFDA (Thermo fisher) and PE anti-CD3 separately ...
-
bioRxiv - Neuroscience 2023Quote: ... slides were washed and incubated 3 h with secondary antibodies: Alexa Fluor 488 (Anti-rabbit, 1:1000, Invitrogen, Themo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Chinese Academy of Sciences) were maintained and passaged every 1–3 days in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were resolved in 3% agarose gel using the 1 Kb DNA ladder plus (Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2023Quote: ... pNL4-3 or pMSMnG were washed and lysed in 1× NuPAGE LDS sample buffer (NP0007, Thermo Fisher Scientific) containing 2% (v/v ...
-
bioRxiv - Bioengineering 2022Quote: Cultured neurons were washed 3 times with 1 mL of pre-warmed serum free Neurobasal medium (Gibco, 21103049) supplemented with 4% B-27 (Gibco ...
-
bioRxiv - Bioengineering 2022Quote: Cultured neurons were washed 3 times with 1 mL of pre-warmed serum free Neurobasal medium (Gibco, 21103049) supplemented with 4% B-27 (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... and blocked for 1 hour at RT in 3% BSA (Applichem) in PBS-Tween buffer (0.01%) (ThermoFisher, Sigma). The membranes were then incubated overnight at 4°C with primary antibodies listed in the Supplemental table 3 with agitation ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 × 108 asynchronised TIG-3-20 cells (per time point) were labeled with 20 μM EdU (Thermo Fisher) for 11 min ...
-
bioRxiv - Neuroscience 2023Quote: ... Tissues were then incubated with the secondary antibody (1:1000; A10520, goat anti-rabbit IgG Cyanine 3, Invitrogen) during 2 h at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... was diluted 1:300 and incubated in 3% normal donkey serum before mounting with Gelvatol containing Hoescht (Invitrogen). Cells were imaged using a Leica SP5 confocal microscope (Leica Microsystems) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mix 1 contains 3 siRNAs (CliniSciences, CRH7929) and Mix 2 contains two siRNAs (ThermoFisher Scientific, 1299001 and 4392420). As a negative control ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with appropriate Alexa Fluor secondary antibodies for 3 h at room temperature (1:250, Invitrogen). Sections were mounted on glass slides and coverslipped using DAPI-Fluoromount-G (Southern Biotech).
-
bioRxiv - Biochemistry 2023Quote: ... 1 mM DTT using 0.5 - 3 mL 3.5 MWCO Slide-A-Lyzer™ Dialysis Cassette (Thermo Fisher Scientific) at 4°C for 4 hours ...
-
bioRxiv - Immunology 2023Quote: ... Silencer® Select Negative Control #1 (4390843) were mixed with 3 µl of LipoRNAiMAX (13778150, Thermo Fisher Scientific), incubated for 10m at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 µl of 1 M imidazole and 30 µl of Ni-NTA agarose beads (Thermo Scientific, MA, USA) were added to the mixture and incubated for 30 min at 4-8°C ...
-
bioRxiv - Bioengineering 2023Quote: ... a ‘shim’ photomask reflecting the geometry of a standard 1’’ x 3’’ microscope slide (12-559-A3, ThermoFisher) was printed at 20,000 d.p.i (CAD/Art Services ...
-
bioRxiv - Genetics 2024Quote: ... for 1-3 hours at 37C and subsequently cleaned up with GeneJet PCR clean up kit (Thermo Scientific) and resuspended in H2O ...
-
bioRxiv - Neuroscience 2024Quote: ... or RGS14 (n=3, 1:500, mouse anti-RGS14 #75-170, Neuromab)/goat anti-mouse IgG2a (Life Technologies).
-
bioRxiv - Cell Biology 2022Quote: ... 750,000 cells per well in a 6-well plate were transfected using Lipofectamine 2000 (5 μL; Thermo Fisher) as needed ...
-
bioRxiv - Biochemistry 2022Quote: ... 5 × 105 landing pad cells expressing hACE2 with mNG21-10 were seeded in 6-well plates (Fisher Scientific). The cells were then then incubated at 37 °C with 5% CO2 for 15 mins to allow seeding ...
-
bioRxiv - Microbiology 2020Quote: ... 1976) and maintained in 6% O2 and 5% CO2 and grown in sterile filtered RPMI 1640 media (Gibco) supplemented with 2 M HEPES ...
-
bioRxiv - Cell Biology 2020Quote: ... at 37°C and 5% CO2 with 6 mL HDF medium consisting of 1x Advanced DMEM (Gibco™), 1x Glutamax™ (Gibco™) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and Cell Counting Kit-8 (CCK-8) were purchased from Fisher Scientific. Syringe filters (PTFE 0.4 µm) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2μl of annealing mix (5% ERCC RNA spike-In Mix (pre-diluted at 1:25,000; Invitrogen), 5% Oligo-dT (5⍰–AAGCAGTGGTATCAACGCAGAGTACT30VN-3⍰ ...
-
bioRxiv - Microbiology 2020Quote: ... and in the presence of 5 μg ml-1 of erythromycin (Acros Organics, New Jersey, USA). The strain was preserved as a glycerol stock at −80° C.
-
bioRxiv - Microbiology 2019Quote: ... unprimed cells were transfected with LPS (5 μg/ml) using Lipofectamine 2000 (1% v/w; Invitrogen).
-
bioRxiv - Neuroscience 2022Quote: ... Sequence PCR (total volume 5 µl) was carried out with 1 µl Big dye (Applied Biosystems), 1 µl Forward primer ...
-
bioRxiv - Immunology 2019Quote: ... Excised lungs were places in DMEM substituted with 5% FBS and 1% Penicillin/Streptomycin (all Gibco). Lungs were immediately sliced into 300μm thick sections on a vibratome and stained with directly conjugated Ab in complete medium (phenol-red free DMEM substituted with 10% FBS ...
-
bioRxiv - Neuroscience 2019Quote: ... and incubated for 5 nights in 1 μg/mL streptavidin conjugated to Alexa Fluor-568 (Invitrogen) in PBS that was supplemented with 1% Triton x-100 and 0.5% dimethylsulfoxide (DMSO ...
-
bioRxiv - Developmental Biology 2021Quote: ... The reaction was quenched 1:5 with wash buffer DMEM/F12 (Thermo Fisher Scientific, 11320-082) containing 0.1% bovine serum albumin (BSA ...
-
bioRxiv - Cell Biology 2020Quote: ... Alexa Fluor 647 donkey anti-mouse IgG (H+L) (A31571) (Molecular Probes, 1:500 (Figure 5) or 1:200 (other figures)).
-
bioRxiv - Bioengineering 2021Quote: ... Cultures were diluted 1:5 in 150 μl with Phosphate Buffer Saline (PBS) from Life Technologies immediately before analysis by flow cytometry on the BD LSR Fortessa X-20 (BD Biosciences) ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg/ml BSA] supplemented with 1 U per 20 µL SUPERase-In RNase Inhibitor (ThermoFisher) and incubated at 37 °C for 1 hour.
-
bioRxiv - Microbiology 2021Quote: ... and incubated in with 1.5 μM of the JC-1 dye (5,5’,6,6’-tetrachloro-1,1’,3,3’-tetraethylbenzimidazolylcarbocyanine Iodide, T3168, Invitrogen) for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 mM each dNTPs and a 1:6,000,000 dilution of ERCC RNA Spike-In Mix (Invitrogen) was added followed by incubation at 72 °C for 3 min ...
-
bioRxiv - Biochemistry 2022Quote: ... 750 µl of live cell medium containing 1 µl of 5 mg/ml Hoechst 33342 (Invitrogen), resulting in a 5 µM concentration of Hoechst 33342 and 5 µg/ml CellMask™ Deep Red and were incubated for another 8 min at 37 °C and 5 % CO2 (total incubation of 30 min) ...
-
bioRxiv - Microbiology 2022Quote: THP-1 cells were diluted to 5 x 105 cells/mL in RPMI + 10% FCS (Gibco) and treated with 100 nM phorbol 12-myrystate-13-acetate (PMA ...