Labshake search
Citations for Thermo Fisher :
5601 - 5650 of 10000+ citations for 6H 1 3 Dioxolo 4 5 g 1 benzopyran 6 one 7 8 dihydro since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... HEK293T cells or EphA2 HEK293T stable cells were seeded (1 x 104 cells/well) into 8-well tissue culture chambered coverglass slides (Thermo Scientific; 12565338) and cultured for 36 hours ...
-
bioRxiv - Molecular Biology 2021Quote: ... pombe cells were mixed in an 8:1 ratio and total RNA was extracted using the RiboPure yeast kit (Ambion, Life Technologies) using the following volumes ...
-
bioRxiv - Plant Biology 2022Quote: ... and surface sterilized with undiluted household bleach (Clorox) at 8% sodium hypochlorite and sown on 1% water agarose (Life Technologies Catalog: 16500100) plates.
-
bioRxiv - Pathology 2023Quote: ... cells were plated uniformly at a density of 1 × 105cells/well in an 8-well chamber slide (ThermoFisher, 154453 or iBidi, 80826). Cells were washed after reaching confluence ...
-
bioRxiv - Developmental Biology 2023Quote: ... Dissected tails were then placed in individual wells of 8-well glass-bottomed dishes (Lab-Tek Chambered #1 Borosilicate Coverglass System 155411, Thermo Scientific Nunc, USA) with 200µl of Gibco CO2 independent medium (Thermo Fisher #18045054).
-
bioRxiv - Biochemistry 2023Quote: ... pombe SY78 cells were mixed in an 8:1 ratio for each condition and RNA was isolated using the Ribopure Yeast Kit (Ambion Cat# AM1924). 40 μg of RNA was biotinylated with 4 μg of MTSEA Biotin XX (Biotium Cat# 90066) ...
-
bioRxiv - Genetics 2023Quote: ... the 17 uL reaction from the previous step was directly used to ‘synthesize first strand cDNA’ by combining this reaction with 8 uL of a master mix containing a ratio of 1 uL of Superscript Reverse Transcriptase II (Invitrogen #18064-014) to 9 uL of FSA (Illumina #20020599) ...
-
bioRxiv - Genomics 2023Quote: ... pombe cells were mixed in an 8:1 ratio and total RNA was extracted using the RiboPure yeast kit (Ambion, Life Technologies) using the following volumes ...
-
bioRxiv - Plant Biology 2024Quote: ... and surface sterilized with undiluted household bleach (Clorox) at 8% sodium hypochlorite and sown on 1% water agarose (Life Technologies Catalog: 16500100) plates (Boschiero et al. ...
-
bioRxiv - Cell Biology 2024Quote: The desired number of wells in a 96-well plate (MGB096-1-2-LG-L; Matrical, Inc.) or an 8-well Lab-Tek II chamber (155409; Thermo Fisher Scientific) were coated with 100 µL or 200 µL of 40 µg/µL porcine fibronectin (prepared from whole blood ...
-
bioRxiv - Cell Biology 2024Quote: ... 50 mM ammonium bicarbonate was added to bring sodium deoxycholate concentration to 1% and 8 μg of LysC/Trypsin mixture (Thermo Fisher Scientific) was added to each sample for overnight digestion at 37 °C ...
-
bioRxiv - Neuroscience 2022Quote: ... Culture 1 1% (Gibco), fetal bovine serum 2.5% and 2 μg/ml doxycycline hydrochloride.
-
bioRxiv - Genetics 2020Quote: ... RNA was quantified using a NanoDrop™ One (#ND-ONE-W, ThermoFisher Scientific) and 2 μg per sample were used for cDNA synthesis by performing a retro-transcription reaction with the SuperScript™ VILO™ cDNA Synthesis Kit (#11754050 ...
-
bioRxiv - Microbiology 2021Quote: ... as measured by NanoDrop One/One Microvolume UV-Vis Spectrophotometer (Thermo Fisher Scientific) was loaded onto a 50-cm μPAC capLC column (PharmaFluidics ...
-
bioRxiv - Microbiology 2022Quote: NanoDrop One Microvolume UV-Vis spectrophotometer (Thermo Fisher Scientific, catalog #: ND-ONE-W).
-
bioRxiv - Cancer Biology 2021Quote: ... RNA purity was assessed using a NanoDrop One (ThermoFisher Scientific, ND-ONE-W). The RNA samples (1μg ...
-
bioRxiv - Microbiology 2022Quote: ... One infected and one uninfected flask were treated with DSS Crosslinker (Thermo Scientific) following manufacturer instructions for intracellular crosslinking ...
-
bioRxiv - Biophysics 2022Quote: ... RNA was then quantified using a Nano Drop One (Thermofisher #ND-ONE-W) and the concentration adjusted to 60 ng/uL ...
-
bioRxiv - Cell Biology 2024Quote: ... Protein concentrations were determined using a NanoDrop One (Thermo Fisher, ND-ONE-W) using absorbance.
-
bioRxiv - Immunology 2023Quote: ... the IgG concentration was determined using NanoDrop One (Thermo Fisher, ND-ONE-W). All monoclonal antibodies were assessed for integrity by SDS-PAGE analysis.
-
bioRxiv - Physiology 2023Quote: ... One hundred microliters of One-step Ultra TMB ELISA substrate (Thermo Scientific #34028) was added to each well ...
-
bioRxiv - Cell Biology 2019Quote: ... for 20 minutes followed by overnight incubation in primary antibodies at 4°C (mouse anti-GM-130, BD Transduction laboratories #610822 1:250; rat anti-VE-cad BV13, ThermoFisher Scientific #14-1441-82 1:500) diluted in blocking buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... Blots were blocked with 5% BSA at room temperature for 1 h and incubated with the following primary antibodies overnight at 4°C: mouse anti-v5 (Thermo Fisher Scientific, Cat. # R96025; 1:2000), mouse anti-Flag M2 (Sigma ...
-
bioRxiv - Molecular Biology 2023Quote: ... the tissues were incubated at 4°C for 1 day with the following secondary antibodies as appropriate: Alexa 546-conjugated anti-mouse IgG (Thermo Fisher, A11030, 1:250–1000 dilution), Alexa 488-conjugated anti-mouse IgG (Thermo Fisher ...
-
bioRxiv - Neuroscience 2020Quote: ... through one channel of each tetrode and subsequent transcardial perfusion with saline followed by 10% buffered formalin (SF100-4, ThermoFisher Scientifc). Brains were extracted and stored in fixative for one day ...
-
bioRxiv - Neuroscience 2021Quote: ... The designated samples were then subjected to one-dimensional gel electrophoresis (1DE) employing precast NuPAGE 4-12% Bis-Tris 10-well mini protein gels (Invitrogen, Germany) with 2-[N-morpholino]ethanesulfonic acid (MOPS ...
-
bioRxiv - Microbiology 2021Quote: Fifty microliters containing 3.5 x 106 PFU/ml SARS-CoV-2 viral stock was placed on one well of a 4-well chambered glass slide (Nunc, Sigma) (Fig 2) ...
-
bioRxiv - Neuroscience 2024Quote: ... were added and incubated for 4 hours at 4°c followed by one wash with lysis buffer (Pierce) with added Halt protease and phosphastase inhibitors (Thermo Scientific) and two washes with PBS and resuspended in PBS for Mass spectrometry.
-
bioRxiv - Biochemistry 2023Quote: ... A drop of 3.5-4 µl sample was applied on one side in a Vitrobot (Vitrobot Mk IV, Thermo Fisher Scientific) at 4 °C and 100 % humidity ...
-
bioRxiv - Microbiology 2023Quote: We diluted freshly purified virus samples in DPBS and combined three volumes of the virus with one volume of NuPAGE LDS Sample Buffer (4×; Thermo Fisher) containing 100 mM dithiothreitol ...
-
bioRxiv - Neuroscience 2021Quote: ... in the presence of 5 ml of ‘neural induction medium’ containing DMEM/F12 supplemented with GlutaMax (1/1; Thermo-Fisher Scientific; Cat. No. 10565-018), Neurobasal medium (1/1 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Prepared 200X dilutions were then diluted to 2X concentration in infection media (Gibco DMEM supplemented with 5% HyClone FetalCloneII, 1% Gibco NEAA, 1% Gibco Pen-Strep). Growth media was removed and cells were pretreated with 2 X drug for 1 hour prior to infection at 37C and 5% CO2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The slides were washed thrice with PBS and blocked with 5 % milk inside a humid chamber for 1 h before being incubated with α-V5 mouse primary antibody (Thermo Fisher Scientific – 1:400) overnight at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Coverslips were then washed 3 x 5 min in PBS and incubated with appropriate secondary antibodies for 1 hr at room temperature (1:1000, ThermoFisher Alexa-Fluor 488, 568, 647). After mounting coverslips onto microscope slides with ProLong gold mounting media (ThermoFisher) ...
-
bioRxiv - Microbiology 2021Quote: ... qPCR was performed on QuantStudio 3 and 5 Real-Time PCR Systems (Thermo Fisher Scientific) based on the following cycling parameters ...
-
bioRxiv - Systems Biology 2019Quote: ... 5’-ACG UGA CAC GUU CGG AGA Att-3’) by Lipofectamine 2000 (Thermo Fisher, #11668019) 48 hr before performing experiment.
-
bioRxiv - Cell Biology 2019Quote: ... CAP-D3 (5-CAUGGAUCUAUGGAGAGUATT-3)29 and control15 were transfected using Oligofectamine transfection reagent (Invitrogen) according to the manufacturer’s instructions and analysed 48h after transfection ...
-
bioRxiv - Genetics 2019Quote: ... 5’ -6FAM CTC AGA GAC ATA TCA AAG ATT CCA GGG-MGB-3’ (Life Technologies). Viral load is expressed on a Log10 scale as viral genome copies per milliliter (plasma samples ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 mM EDTA) and settled for 3 min in a magnetic stand (Fisher scientific, #FERMR02). Beads were then resuspended in 1 volume of IP buffer and ready to use ...
-
bioRxiv - Molecular Biology 2022Quote: ... Grids were blotted for 3 - 5 s in a Vitrobot (Mark IV, Thermo Fisher Scientific) at 20 °C and 100% humidity ...
-
bioRxiv - Cell Biology 2022Quote: Control siRNA against Luciferase (siLuc) was custom ordered from Life technologies (sense: 5’-uaugcaguugcucuccagcdtdt-3’). Individual or pooled siRNAs against other targets were ordered from Horizon Discovery (Dharmacon) ...
-
bioRxiv - Microbiology 2019Quote: ... Primer 2: 5’-GGATGTTCGTCCAGTGAGATTAG-3’) using a 7500 Fast Real-Time PCR System (Applied Biosystems) and accompanying software to analyze qPCR data.
-
bioRxiv - Synthetic Biology 2019Quote: ... and MIT_v2.1_SbfInifJ_RV2 5’-AACCTGCAGGGCTAACTAACTAACCACGGACAAAAAACC-3’) and ligated into pCR Blunt II TOPO (Thermo Fisher Scientific). The second half containing nifBQFUSVWZM was amplified with SbfI sites on either end (with oligos MIT_v2.1_SbfInifB_FW 5’-AACCTGCAGGTACTCTAACCCCATCGGCCGTCTTA-3’ ...
-
bioRxiv - Developmental Biology 2019Quote: For live imaging 3-5 day old flies were dissected in Schneider’s Insect Media (Thermofisher) supplemented with 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Genetics 2021Quote: ... 3×105 U2OS cells were incubated with 5 pmol siRNA using lipofectamine RNAiMAX (Thermo Fisher) in a 12-well tissue culture plate for 2hr ...
-
bioRxiv - Genomics 2021Quote: ... Erythrocytes were lysed by treatment with 3-5 mL ACK lysing buffer (Gibco, Cat#A1049201) for 5 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... London) were transiently transfected with the following antisense oligos: ROD1 (5′ GGAAUGAUAUUGAGCUGCUAACAAA 3′; ThermoFisher Scientific), TACC3 (5’ GAGCGGACCUGUAAAACUA 3’ ...
-
bioRxiv - Neuroscience 2024Quote: ... 3-5 mm skin biopsies were collected in Biopsy Collection Medium (RPMI 1460 [Thermo Fisher] with 1X Antibiotic-Antimycotic [Thermo Fisher]) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Add pre-mix chewing solution (5 μl 10xNEBbuffer2.1, 3 μl 100 mM DTT (ThermoFisher, A39255), 2 μl 100 mM ATP (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... homogenized and placed in sterile 5 mL Eppendorf tubes containing 3 mL of RNAlater (ThermoFisher). The tubes were stored at -20°C upon our arrival in the laboratory ...