Labshake search
Citations for Thermo Fisher :
5051 - 5100 of 10000+ citations for 2 3 5 6 Tetrahydroxy 4 phosphonooxycyclohexyl dihydrogen phosphate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... glacial acetic acid) for 2 hours at room temperature (Section 2.14) or methanol-free 4% formaldehyde (ThermoFisher, Section 2.16) and then kept in PBS at 4°C before washing in gradations of ethanol up to 100% ...
-
bioRxiv - Microbiology 2021Quote: ... Previously pelleted spheroplasts were resuspended in 1 mL 10mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffer solution (Gibco) and 100 μl were collected as whole spheroplasts ...
-
bioRxiv - Microbiology 2020Quote: ... were quantified using an avidin and 4’-hydroxyazobenzene-2-carbocylic acid assay according to the manufacturer’s instructions (Fisher Scientific). Briefly ...
-
bioRxiv - Cell Biology 2020Quote: ... Ni-NTA His.Bind® Resin (2-4 ml) was packed into a 10 ml Pierce disposable column (Thermo Fisher) and connected to the peristaltic pump ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Homogenised leaf tissues were centrifuged at 18,000 g 10 min 4 °C and 2 μL supernatant mixed with 48 μL Bradford reagent (ThermoFisher Scientific ...
-
bioRxiv - Biophysics 2020Quote: ... Grids were blotted for 4 seconds at -2 force and vitrified in liquid ethane using a MarkIV Vitrobot (ThermoFisher). The blotting chamber was maintained at 22°C and 100% humidity during freezing.
-
bioRxiv - Cell Biology 2020Quote: ... The immunoprecipitates were dissolved in 2×SDS loading buffer and resolved on NuPAGE 4–12% Bis-Tris gel (Invitrogen), and then silver stained using Pierce silver stain kit (Thermo) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Tissues were immersed in 2ml dissociation solution (2% FCS-PBS solution with approximate 145U/ml type 4 Gibco collagenase) and incubated at 37°C for 30 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... and MUTYH KO cells were obtained by infection of BJ FAP-TRF1 WT with lentivirus expressing respectively guide RNAs targeting OGG1 exon 4 (gRNA3, sequence GCTACGAGAGTCCTCATATG) and MUTYH exon 2 (gRNA5, sequence GCATGCTAAGAACAACAGTC) and selected with 1.5 µg/ml Puromycin (Gibco). OGG1 KO/MUTYH KO (DKO ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were passaged with 80-90% confluence at a split ratio of 1:2-1:4 using TrypLE (Gibco) for 8 min at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... The obtained cDNA was diluted to 2-4 ng/µl for subsequent qPCR with the Sybr Green (Applied Biosystems) method ...
-
The logic of native enhancer-promoter compatibility and cell-type-specific gene expression variationbioRxiv - Genomics 2022Quote: ... All cell lines were passaged regularly (every 2 to 4 days) with Accutase (PAA) or TrypLE (Thermo Fisher Scientific), and ESCs and EpiSCs were occasionally selected for Oct4 expression with 1µg/ml puromycin (Sigma) ...
-
bioRxiv - Microbiology 2024Quote: ... and 2 µL RNase A/T1 Mix (4 µg RNase A, 10 U RNase T1, ThermoFisher Scientific, MA, USA) at 37°C for 30 min to remove host-originating nucleic acids ...
-
bioRxiv - Microbiology 2023Quote: ... 2 ug of EV protein content were separated on a 4-12% Bis-Tris gel (Thermo Scientific, Rockford, IL), then blotted onto a PVDF membrane ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μL of capture Ab (~4 μg/ml) or SARS-CoV-2 recombinant antigen (~0.2 mg/ml) in 1x PBS (Gibco) was loaded in each channel ...
-
bioRxiv - Cancer Biology 2022Quote: ... thinly sliced (1-2 mm) tissue samples were fixed overnight at 4°C in neutral-buffered formalin (Fisher Scientific) with PhosSTOP added (Roche) ...
-
bioRxiv - Developmental Biology 2022Quote: ... for 2 hours at 250mA and 4°C using cold transfer buffer (1.5x NuPAGE transfer buffer (Thermo Fisher Scientific), 10% methanol ...
-
bioRxiv - Cell Biology 2022Quote: ... or 2-well and 4-well chamber slides were transiently transfected with various cDNA constructs using Lipofectamine 2000 (Invitrogen) or FuGENE 6 (Promega ...
-
bioRxiv - Microbiology 2022Quote: ... PCDH1 variants (sEC1-2 and sEC1-4) were generated by cloning the following sequences into the pcDNA3.1 mammalian expression vector (ThermoFisher): EC1-EC2 (residues 1-284 ...
-
bioRxiv - Neuroscience 2023Quote: ... and concentrated by centrifugation at 85,000x g for 2 hours at 4°C in a Sorvall WX 100 Ultra Ultracentrifuge (ThermoFisher). The supernatant was discarded and viral pellet resuspended in a volume of PBS containing calcium and magnesium (#14090-055 ...
-
bioRxiv - Neuroscience 2023Quote: ... p21) and pAAV target plasmid in a 4:1:1:2 molar ratio by use of Lipofectamine 2000 (ThermoFisher) according to company protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were stored in 2% PFA at 4°C prior to analysis using an Attune NxT Flow Cytometer (Invitrogen) in the Flow Cytometry Core Facility of the Faculty of Medicine & Dentistry at the University of Alberta ...
-
bioRxiv - Microbiology 2023Quote: ... (BEI NR-52310) or pSARS2-SΔCT and 4 μg pTRMPSS2 (VRC/NIAID) diluted in 2 mL OPTIMEM media (Gibco) (DNA OPTIMEM mixture) ...
-
Entorhinal cortex vulnerability to human APP expression promotes hyperexcitability and tau pathologybioRxiv - Neuroscience 2024Quote: ... 2/3rd of the eluted protein samples were resolved on a 4–12% Bris-Tris gel (Invitrogen: cat# NW04125box) and subjected to Silverstein (Pierce™ Silver Stain Kit ...
-
bioRxiv - Bioengineering 2024Quote: ... PEGαMA hydrogels were made by dissolving the PEGαMA in pH 8.4 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES; Life Technologies) at 12.5-15.5 weight percent (wt%) ...
-
bioRxiv - Neuroscience 2024Quote: ... After 2-4 h the coverslips were flipped over an astroglia feeder layer in Neurobasal medium (GIBCO - Life Technologies) supplemented with SM1 supplement (1:50 dilution ...
-
bioRxiv - Neuroscience 2024Quote: ... After 2-4 h the coverslips were flipped over an astroglia feeder layer in Neurobasal medium (GIBCO - Life Technologies) supplemented with SM1 supplement (1:50 dilution ...
-
bioRxiv - Immunology 2024Quote: ... fluorescent antibodies (4 µg/mouse) and dyes (2 µl of a 10 mM Sytox Green solution; Thermo Fisher Scientific) were dissolved in 100 µl sterile PBS and injected intravenously 10 minutes before the surgery ...
-
bioRxiv - Molecular Biology 2024Quote: shRNA transfected cells were treated with 2 mM HU for 4 h along with 0.1 µg/mL colcemid (KaryoMAX, Gibco) 30 h post-transfection ...
-
DeFrND: detergent-free reconstitution into native nanodiscs with designer membrane scaffold peptidesbioRxiv - Biophysics 2024Quote: ... N,N’-Dimethyl-N-(Iodoacetyl)-N’-(7-Nitrobenz-2-Oxa-1,3-Diazol-4-yl)Ethylenediamine (IANBD amide) and Oregon GreenTM 488 (OG) maleimide were obtained from ThermoFisher. All other chemicals were acquired from Sigma.
-
bioRxiv - Cell Biology 2024Quote: ... then fixed with 4% formaldehyde in HBSS for 2 hrs and stained with Alexa Fluor 568 phalloidin (0.5 U/ml, Invitrogen) in PBS with 0.1% Triton X-100 (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... which was boiled in the SDS loading buffer with 5% β-mercaptoethanol (Cat. #60-24-2, Acros Organics). The denatured protein samples were separated by Novex™ WedgeWell™ 4-20% SDS-PAGE Tris-Glycine gel and transferred to PVDF membrane (iBlot™ 2 Transfer Stacks ...
-
bioRxiv - Genomics 2020Quote: ... Here, 40 μL pre-mix (5 μL 10x NEBuffer 2.1, 2 μL 100 mM ATP (Thermo Fisher, R0441), 3 μL 100 mM DTT ...
-
bioRxiv - Developmental Biology 2021Quote: ... These vectors were co-transfected into GATA3 reporter cells (G3KI#5-2) using the Lipofectamine Stem reagent (Invitrogen). Two days after transfection ...
-
bioRxiv - Immunology 2021Quote: ... we measured the proliferation capacity of NK92 cells by an EdU (5- ethynyl-2’-deoxyuridine; Invitrogen, California, USA) proliferation assay ...
-
bioRxiv - Biochemistry 2020Quote: ... and an Acclaim PepMap 100 trap column (100 μm × 2 cm, nanoViper, C18, 5 μm, 100Å; Thermo Scientific) were used to separate tryptic peptides by increasing concentrations of 80% acetonitrile (can ...
-
bioRxiv - Microbiology 2021Quote: ... and an Acclaim PepMap 100 trap column (100 µm × 2 cm, nanoViper, C18, 5 µm, 100Å; Thermo Scientific), the tryptic peptides were separated by increasing concentrations of 80% acetonitrile (ACN ...
-
bioRxiv - Microbiology 2021Quote: ... the monolayers were overlaid with 2 ml of Minimal Essential Medium (Mediatech) supplemented with 5% FBS (Life Technologies), nonessential amino acids (Gibco) ...
-
bioRxiv - Bioengineering 2022Quote: ... and blocked for 2 hours with a solution containing 0.5% TritonX-100 and 5% donkey serum (Thermo Fisher). Primary antibodies used were rat CD68 (FA-11 ...
-
bioRxiv - Microbiology 2020Quote: Cells grown until A600 of ∼0.1 were labelled with 10 μM EdU (5-Ethynyl-2’-deoxyuridine, Thermofisher, C10337) for 15 min after which cells were washed ...
-
bioRxiv - Neuroscience 2021Quote: ... Pipettes had resistances of 5–7 MΩ when filled with this solution supplemented with Fura-2 (Molecular Probes). Recordings were made using a Multiclamp 700B amplifier (Molecular Devices ...
-
bioRxiv - Immunology 2020Quote: ... the proliferation capacity of NK92 cells was measured by an EdU (5-ethynyl-2 ‘-deoxyuridine, Invitrogen, CA, USA) proliferation assay ...
-
bioRxiv - Biophysics 2021Quote: ... Cells were incubated with 10 μM of the synthetic nucleoside 5-Ethynyl-2’-deoxyuridine (EdU) (Thermo Fisher Scientific) for 25 min at 37°C and 5% CO2.
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were then treated with ExoSAP-IT enzyme (2 μl of enzyme for 5 μl of sample, ThermoFisher) at 37 °C for 15 min followed by a 15 min inactivation at 80 °C ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5-ethynyl-2’-deoxyuridine (EdU)) staining were performed using the Click-iT Plus EdU Assay kit (C10339; Invitrogen) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... Probes consisting of oligodeoxyribonucleotides (see Supplementary Table 2) were 5′-end labeled using T4 polynucleotide kinase (ThermoFisher Scientific) with 25 μCi of [γ-32P]dATP ...
-
bioRxiv - Molecular Biology 2021Quote: ... and HeLa (ATCC CCL-2) cells were cultured at 37 °C with 5% CO2 in Dulbecco’s modified Eagle’s medium (Invitrogen) supplemented with 10% fetal bovine serum ...
-
bioRxiv - Biochemistry 2021Quote: ... by heating at 95 °C for 5 min with 2 µL of SDS-PAGE loading dye (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell proliferation flow cytometry assays were performed using the 5-ethynyl-2’deoxyuridine (EdU) assay kit (Invitrogen #C10634). Cells were incubated with EdU for 24 h and labeled ...
-
bioRxiv - Microbiology 2022Quote: ... and an Acclaim PepMap 100 trap column (100 μm × 2 cm, nanoViper, C18, 5 μm, 100Å; Thermo Scientific), the tryptic peptides were separated by increasing concentrations of 80% acetonitrile (ACN ...