Labshake search
Citations for New England Biolabs :
4251 - 4300 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... the hCD19t and mCD19t cDNAs were PCR-amplified from the plasmids hCD19t-2A-IL2-pHIV7 and mCD19t-epHIV7 using Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) and the primers ...
-
bioRxiv - Cancer Biology 2020Quote: ... Full-length TP53 and RB1 cDNA sequences from each of the samples were amplified by PCR using Phusion High-Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA, USA). PCR products were electrophoresed on agarose gels ...
-
bioRxiv - Biochemistry 2020Quote: ... The PCR amplification was performed with 10 µl of the reverse transcriptase product in a 50 µl PCR mix containing 1 unit of Phusion High-Fidelity DNA polymerase (New England Biolabs, Évry-Courcouronnes, France), 1X HF Phusion buffer ...
-
bioRxiv - Genomics 2021Quote: Individual clones were assessed for PDCL3P4 knockout by performing a genotyping PCR with Q5® High-Fidelity DNA Polymerase (New England BioLabs cat # M0492S) and primers placed outside of the gRNA cut sites ...
-
bioRxiv - Physiology 2020Quote: ... and the coding regions of the two isoforms were amplified using Q5® Hot Start High-Fidelity 2X Master Mix (New England Biolabs, MA, USA) using isoform-specific primers (Supplemental Table 1) ...
-
bioRxiv - Physiology 2021Quote: ... The full length ayRhp1 sequence was obtained following two rounds of RT-PCR using Phusion High Fidelity taq polymerase (New England Biolabs, Ipswitch, MA, USA) and NucleoSpin gel purification (Macherey-Nagel ...
-
bioRxiv - Synthetic Biology 2020Quote: ... which were either digested with restriction enzymes purchased from New England Biolabs (Ipswich, MA, USA) or were used as a template for PCR using Q5 High-Fidelity Polymerase (New England Biolabs, Ipswich, MA, USA). The plasmid pEG1675 developed by Goh et al ...
-
bioRxiv - Developmental Biology 2020Quote: ... we amplified PCR fragments with the respective primers containing the gRNA sequences (Table S1) and utilizing Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs, Cat. No: M0494L). After gel-purification of the PCR fragments with the QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Developmental Biology 2020Quote: ... was amplified from yw DNA with the primers KpnI-twiVLM-fw (GGGGT ACCCCCAGTAAGGCAAATTGCTCAG) and XhoI-twiVLM-rev (CCGCTCGAGCGGAACTTGC CTTGTCCTTCGTC) utilizing Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs, Cat. No: M0494L). The resulting PCR product was gel purified with the QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Genetics 2019Quote: The DNA fragment of the synthetic sgRNA expression cassettes was PCR amplified with high fidelity Taq DNA polymerase (NEB Phusion® Cat#M0530S) using the forward and reverse primers 5’-aggctcccgggtgcgtcgacggtctcaggtcagagcttg-3’ and 5’-gaaagctgggtgattcaagcttggtctcatcagggatccaaaag-3’ respectively ...
-
bioRxiv - Genomics 2021Quote: Duplicate PCR reactions were set up for each sample with Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs, Ipswich, MA, USA) in a 15 μL reaction volume ...
-
bioRxiv - Plant Biology 2021Quote: ... Detection of editing in the EBE region of CsLOB1 promoter was performed by amplifying the target region (primers in Supplementary Table 3) with high fidelity DNA polymerase Q5 (New England Biolabs, Ipswich, MA, USA), followed by cloning of PCR products and sequencing.
-
bioRxiv - Evolutionary Biology 2021Quote: ... cDNA (2.5 μL) was amplified in two multiplexed PCR reactions using Q5 Hot-Start DNA High-fidelity Polymerase (New England Biolabs, Ipswich, MA, USA) using the following cycling conditions ...
-
bioRxiv - Molecular Biology 2021Quote: ... To construct JRY101 (Mpe1-mAID) the mAID insert was amplified from pST1933 (Tanaka et al., 2015) using Phusion high- fidelity DNA Polymerase (NEB, cat. no. M0530S), transformed into YMK728 (WT ...
-
bioRxiv - Genetics 2019Quote: ... These cDNA templates were amplified through 23-30 cycles of PCR using Phusion High-Fidelity master mix (New England Biolabs, Ipswich, MA, USA). For MHC class I sequencing ...
-
bioRxiv - Cancer Biology 2022Quote: Recombinant expression plasmids were constructed by PCR amplification of both vector and insert sequences using Q5® High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA) followed by a Gibson assembly reaction using NEBuilder HiFi DNA Assembly Cloning Kit ...
-
bioRxiv - Biochemistry 2022Quote: ... the plasmid pENTR-PpMAX1c (pYL859) was employed as a template and was amplified using phusion high-fidelity DNA polymerase (New England Biolabs, Ipswich, MA, USA). The PCR products was purified ...
-
bioRxiv - Plant Biology 2022Quote: All PCR reactions were performed using the Q5 High-Fidelity DNA Polymerase and the ligation reactions with the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs Inc., Ipswich, MA). To generate the binary vector for making MED14 transgenic lines ...
-
bioRxiv - Microbiology 2022Quote: ... magnetosome genes were PCR amplified from the G2-11 genome using the high-fidelity Q5® polymerase (New England Biolabs, New England USA) and cloned by restriction sites into the pBamII-Tc vector (Supplementary Table S4) ...
-
bioRxiv - Systems Biology 2022Quote: ... and the coding region of the gene was amplified using Q5® Hot Start High-Fidelity 2X Master Mix (New England Biolabs, MA, USA) using Nha1-specific primers (Supplemental Table 2) ...
-
bioRxiv - Plant Biology 2022Quote: ... All genes were cloned into the MoClo pYTK001 entry vector using the Esp3I (a high-fidelity analog of BsmBI) restriction enzyme (NEB, Ipswitch, MA, USA). The following point mutations were made in DlCYP87A4 using primers ...
-
bioRxiv - Immunology 2024Quote: ... The 16S rRNA gene spanning variable regions V3+V4 was amplified using the broad-range forward primer 341F: CCTAYGGGRBGCASCAG and the reverse primer 806R: GGACTACNNGGGTATCTAAT using the Phusion® High-Fidelity PCR Master Mix (New England Biolabs, Beverley, MA). The PCR amplification program consisted of (1 ...
-
bioRxiv - Immunology 2024Quote: ... The following PCR primers were used to amplify cut sites with Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs, Ipswich, MA, USA): IRF4 5’ - AGGTGCCTTCTTCCGGGG – 3’ & 5’ - TTGCGTGGAAACGAGAACGC – 3’ ...
-
bioRxiv - Genetics 2023Quote: ... and PCRs to define the structure of the MRP3 alleles were performed using Q5® High-Fidelity DNA Polymerase (New England Biolabs, Massachusetts, USA), according to the manufacturer’s instructions using the primers reported in Russo et al ...
-
bioRxiv - Genomics 2023Quote: ... The resulting DNA fragments were then either methylated using non-specific adenine EcoGII methyltransferase (New England Biolabs, high concentration stock 2.5e4 U/mL) or left unmethylated ...
-
bioRxiv - Microbiology 2023Quote: ... The regions upstream and downstream of the operon were then amplified using Q5 High-Fidelity 2X Master Mix (New England Biolabs, Ipswich, Massachusetts, USA) with the following primers that contain overlapping regions with the plasmid pG+host9 (Maguin et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... Mutations in the helicase encoding domain of the DDX3X cDNA were introduced by the site-directed mutagenesis using the Phusion High Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA, USA) by overlap extension PCR method as described (20).
-
bioRxiv - Microbiology 2023Quote: ... the V1-V3 variable region of the 16S rRNA gene was amplified using the Q5 Hot Start High-Fidelity DNA polymerase (New England Biolabs, Ipswich, Massachusetts, USA), and primers 27F-YM (5’-AGAGTTTGATYMTGGCTCAG-3’ ...
-
bioRxiv - Genomics 2023Quote: ... The purified product was then used as template for a subsequent amplicon PCRs using 0.5 U Q5® High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA, USA) 0.5 U ...
-
bioRxiv - Genomics 2023Quote: ... Amplification of the libraries was performed for 13 PCR cycles using the Phusion High-Fidelity PCR Master Mix (New England Biolabs, cat. no. M0531L); 6-bp molecular barcodes were also incorporated during this PCR amplification ...
-
bioRxiv - Cell Biology 2023Quote: ... Human MYPT1 and PKA-R and fragments thereof were amplified by PCR using Q5® High-Fidelity DNA polymerase (New England Biolabs, Herts, UK) and subcloned into appropriate vectors for expression as Myc tag fusions in mammalian cells or for expression in E ...
-
bioRxiv - Plant Biology 2023Quote: ... and downstream (536 bp) regions of ripU were amplified from Rs K60 gDNA using Q5 high fidelity DNA polymerase (New England Biolabs, Ipswich, MA, USA) with the primers ripU up F/R and ripU dw F/R (Supplemental Table 1) ...
-
bioRxiv - Genetics 2023Quote: ... 100 pmol of template oligos and 125 pmol IRDye 700-labeled reverse complement primer F1 were mixed in Phusion® High-Fidelity PCR Master Mix (NEB, Ipswich, MA). A 15s denaturing at 95°C following a 10-minute extension at 52°C afforded duplex DNAs ...
-
bioRxiv - Zoology 2024Quote: The complete open reading frames of AedaeCCHa1R and AedaeCCHa2R were amplified by PCR using Q5 high-fidelity DNA polymerase (New England Biolabs, Whitby, ON, Canada) with primers located upstream of the start codon and downstream of the stop codon (Supplement Table S1 ...
-
bioRxiv - Physiology 2024Quote: ... and PCR was performed with Flag F (caaggacgacgatgacaaagtc) + 3’OUTR (CAGAGCCAACAACGTGAGGT) primers using Q5® High-Fidelity DNA Polymerase (New England Biolabs, MA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Amplification was achieved through 16S rRNA gene Polymerase Chain Reaction (PCR) with Illumina (San Diego, USA) adapted primers [50] and NEBNext® High-Fidelity 2X PCR Master Mix (New England Biolabs, Ipswich, USA) at 98°C (2 minutes ...
-
bioRxiv - Bioengineering 2023Quote: ... DNA fragments were either amplified from available plasmids or synthesized gBlocks™ (Integrated DNA Technologies) using Q5 Hotstart Start High-Fidelity 2X Master Mix (New England Biolabs, Cat. #M0494S). The generated plasmids were transformed into Zymo JM109 chemically competent E ...
-
bioRxiv - Genetics 2024Quote: ... genomic DNA (transfected plasmid DNA) and plasmid DNA samples (that was used for transfection) with Phusion High-Fidelity PCR Master Mix (NEB Catalog no. M0531S) using primer set KC_BC (Table S4 ...
-
bioRxiv - Cell Biology 2024Quote: ... by linearizing the vector with 15 base pairs (bp) overlapped primers using Phusion high-fidelity DNA polymerase (New England Biolabs, cat. no. MO531L). PCR products were digested using Dpn I (Takara ...
-
bioRxiv - Genomics 2024Quote: The 493 gRNAs with associated 10N random barcodes were ordered as an IDT oPool and PCR amplified with Q5 High-Fidelity polymerase (NEB, Cat. No. M0491S) to make double stranded DNA ...
-
bioRxiv - Microbiology 2024Quote: ... SARS-CoV-2-specific amplicons were generated using xGen Artic V4 NCoV-2019 primers (Integrated DNA Technologies Inc., Coralville, Iowa) and Q5 Hot Start High Fidelity PCR Master Mix (New England Biolabs, Cat. no. E0555S). Sequencing libraries were prepared using NEBNext ultra II DNA library kit (New England Biolabs ...
-
bioRxiv - Physiology 2024Quote: ... for site-directed mutagenesis to generate nonsense mutations in mouse Mypbhl using Q5 Hot Start High-Fidelity (New England Biolabs, Cat No: M0494S). Plasmids were sequenced by Sanger reaction (Azenta Life Sciences ...
-
bioRxiv - Molecular Biology 2024Quote: ... each containing 50 ng of DNA (comprising both vector and insert at a 1:3 molar ratio) and high-concentration T4 DNA ligase (NEB Cat No. M0202T). The ligation mix was incubated at 16°C overnight and column-purified with molecular biology-grade water ...
-
bioRxiv - Bioengineering 2024Quote: ... Constant regions of target constructs were amplified using Phusion® High-Fidelity DNA Polymerase according to manufacturer recommendations (New England Biolabs, Catalog # M0530L). For small libraries (1- or 2-site libraries ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Escherichia coli and Myxcococcus xanthus were amplified from genomic DNA by PCR (Q5® High-Fidelity 2X Master Mix, New England Biolabs, USA-MA) and introduced into the pLIC expression vector55 by Gibson cloning (Gibson Assembly Master Mix ...
-
bioRxiv - Genetics 2024Quote: ... An amplicon DNA library was made by designing amplicons to the coding regions of NR1H3 and PCR was undertaken using Q5® Hot Start High-Fidelity 2X Master Mix (Catalogue number M0494S, New England Biolabs® Inc) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... The supernatant was loaded on a 10-mL chitin column (NEB). The column was washed with HEGX ...
-
bioRxiv - Biochemistry 2022Quote: ... 10 u/μL T4 DNA ligase (stock 400 u/μL, NEB). No difference in yield was found between the ligation splints ...
-
bioRxiv - Molecular Biology 2021Quote: ... were then combined with 10 μM CLIP-Biotin (New England Biolabs) and rotated (end-over-end ...
-
bioRxiv - Developmental Biology 2022Quote: ... in HBSS supplemented with 10 µg/ml DNase (New England Biolabs) at 37°C and swirled at 100 rpm for 32 minutes to enzymatically separate the epithelium from the mesenchyme as we previously did [47] ...