Labshake search
Citations for New England Biolabs :
3701 - 3750 of 7434 citations for rno mir 129 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2020Quote: ... PCR reactions were performed using Q5 high fidelity polymerase (New England Biolabs). Correct PCR products were digested with DpnI (New England Biolabs ...
-
bioRxiv - Bioengineering 2019Quote: ... Target sites were amplified using High Fidelity 2X PCR Master Mix (NEB). Primers used for PCR are listed in Supplementary Materials ...
-
bioRxiv - Biochemistry 2019Quote: All PCR reactions were performed using a Q5 DNA polymerase kit (NEB) and manufacturer recommended concentrations of primers ...
-
bioRxiv - Biochemistry 2019Quote: ... was generated by PCR with the Phusion high-fidelity DNA polymerase (NEB). The DNA fragment was cloned into BamHI and SalI digested pGST parallel1 vector (Sheffield et al. ...
-
bioRxiv - Molecular Biology 2021Quote: Codon-optimized Nsp1 wt was amplified by PCR with Q5 polymerase (NEB) from the plasmid pDONR207 SARS-CoV-2 NSP1 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and/or Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB) (Table S2) ...
-
bioRxiv - Systems Biology 2020Quote: ... a 4-cycle PCR was performed with OneTaq polymerase (New England Biolabs) in 200 reactions (125 μL/reaction) ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR was performed with Phusion® High-Fidelity DNA Polymerase (M0530L, NEB) for 40 cycles with the protocol provided by the manufacturer.
-
bioRxiv - Cell Biology 2021Quote: ... PCR reactions were carried with the proof-reading Phusion DNA polymerase (NEB). Reaction conditions were according to the enzyme manufacturer's instructions with annealing temperatures chosen based on primers.
-
bioRxiv - Bioengineering 2021Quote: ... The obtained PCR products were subsequently treated with DPNI (New England Biolabs) and cleaned up with the Qiaquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Neuroscience 2021Quote: ... The PCR product was digested using restriction enzyme PspGI (New England Biolabs), which cleaves wildtype product into 131bp and 157bp fragments ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCRs were performed using either Q5 DNA Polymerase (NEB, Ipswich, Massachusetts, M0491) or OneTaq DNA Polymerase (NEB M0480) ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR fragments were amplified with Q5 polymerase (New England Biolabs, NEB, # M0491L). DNA fragments were isolated using the Qiaprep spin miniprep kit (Qiagen) ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR fragments were amplified with Q5 polymerase (New England Biolabs, NEB, # M0491L). DNA fragments were isolated using the Qiaprep spin miniprep kit (Qiagen) ...
-
bioRxiv - Biochemistry 2021Quote: ... The PCR product was then added to a KLD enzyme mix (NEB) reaction and was incubated at room temperature for 1 hour ...
-
bioRxiv - Cell Biology 2021Quote: ... The PCR product was digested with EcoRI and BamHI (New England Biolabs), and ligated into pmCherry-N1 and pEGFP-N1 plasmids that had been digested with the same restriction enzymes.
-
bioRxiv - Neuroscience 2021Quote: ... PCRs were performed using OneTaq 2X Master Mix with Standard Buffer (NEB) using the following primers ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Backbone PCR amplicons were treated with BsaI and DpnI (New England Biolabs) to generate overhangs for oligo insertion and to remove any template plasmid ...
-
bioRxiv - Microbiology 2020Quote: ... PCR (NEBNext Ultra II Q5 ® Master Mix, NEB, Ipswich, MA, USA) was performed with a gene-specific forward primer designed 700-nt upstream of the apparent boundary between the SARS-CoV-2 genome body and the putative poly-A tail ...
-
bioRxiv - Microbiology 2020Quote: ... Libraries were indexed using NEBNext High-Fidelity PCR Master Mix (NEB M0541S) for 11 cycles (size-matched input ...
-
bioRxiv - Plant Biology 2021Quote: ... PCR products were generated using Q5® High- Fidelity DNA Polymerase (NEB) and column-purified by using GeneJET PCR Purification Kit (ThermoFisher) ...
-
bioRxiv - Neuroscience 2020Quote: ... Colony PCR was performed on each colony with OneTaq (New England Biolabs). The PCR products were purified with Nucleospin (Macherey-Nagel ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were cloned with the NEBuilder HiFi DNA Assembly reaction (NEB) into the SacI and XbaI sites of pCM009 (30) ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR product was digested with restriction enzymes (New England Biolabs, NEB), followed by ligated to linearized plasmid using T4 DNA ligase (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR product was digested with restriction enzymes (New England Biolabs, NEB), followed by ligated to linearized plasmid using T4 DNA ligase (NEB) ...
-
bioRxiv - Microbiology 2021Quote: All PCR products were synthesized using Phusion HF polymerase (New England Biolabs). Sequencing of constructs and strains was performed at Eurofins Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR products were loaded with 6X purple gel loading dye (B7025, NEB) and electrophoresed alongside a low molecular weight ladder (range 25 to 766 base pairs ...
-
bioRxiv - Biochemistry 2020Quote: ... PCR amplifications were carried out using 2 x Q5 Master Mix (NEB), with cycling times and temperatures according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µl of sample was used in PCR with OneTaq polymerase (NEB) with primers Cas168 GGGACAGATACGCGTTTGAT and Cas169 GCCTAACTGAACGGTTTGA as described previously (31) ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was performed using Q5 Taq polymerase (New England Biolabs, Ipswich, MA), with the following cycling conditions ...
-
bioRxiv - Microbiology 2019Quote: ... Amplicons were generated using Q5 PCR Master Mix (NEB, Ipswich, MA, USA), and the resulting PCR products were cleaned using a NucleoSpin Gel and PCR Clean-Up kit (Macherey-Nagel ...
-
Identification and biochemical characterization of a novel eukaryotic-like Ser/Thr kinase in E. colibioRxiv - Microbiology 2020Quote: ... PCR amplification was performed using Q5 hotstart high fidelity master mix (NEB) with respective primers and 2 ng of Plasmid pKR72 as template DNA ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP or mCherry2 with Bgl2 sites was generated by Phusion PCR (NEB) with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg ...
-
bioRxiv - Neuroscience 2022Quote: ... before carrying out PCR amplification with NEBNext Multiplex Oligos (New England Biolabs) to barcode each library ...
-
bioRxiv - Microbiology 2022Quote: ... the PCR product was digested with NdeI and HindIII (NEB, Ipswich, MA). The digested product was then ligated with a NdeI and HindIII cut pCT94 using Gibson assembly (NEB ...
-
bioRxiv - Synthetic Biology 2022Quote: ... PCR reactions were performed using Q5 high fidelity polymerase (New England Biolabs). Correct PCR products were digested with DpnI (New England Biolabs ...
-
Comprehensive fitness landscape of SARS-CoV-2 Mpro reveals insights into viral resistance mechanismsbioRxiv - Molecular Biology 2022Quote: ... Barcodes were amplified with 22 cycles of PCR using Phusion polymerase (NEB) and primers that add Illumina adapter sequences and a 6 bp identifier sequence used to distinguish cell populations ...
-
bioRxiv - Neuroscience 2022Quote: ... the targeted region was amplified by PCR using the Q5 polymerase (NEB) with 100 -200 ng of genomic DNA as a template ...
-
bioRxiv - Developmental Biology 2022Quote: ... and then cleaned up using the Monarch PCR Cleanup kit (T1030L, NEB). Digested PCR products were then ligated to the digested pcs2+MCS-P2A-sfGFP plasmid using T4 DNA ligase (M0202S ...
-
bioRxiv - Genomics 2022Quote: ... PCR products were purified by gel extraction (Monarch gel extraction kit, NEB), and assembled into the backbones using NEB HiFi DNA Assembly master mix kit ...
-
bioRxiv - Microbiology 2022Quote: ... Real-time PCR was measured using the SYBR green master mix (NEB). Cq was used to calculate the relative expression of the target gene by the 2-ΔΔ Cq method ...
-
bioRxiv - Immunology 2022Quote: ... A second round of PCR (25 cycles with the Phusion from NEB) was performed to add the Illumina adapters containing the different indexes ...
-
bioRxiv - Microbiology 2022Quote: ... 20 μl of nested PCR product was digested using AvaII (NEB, R0153S) for 7-12 h at 37°C in CutSmart buffer (NEB ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR amplicons along with 100 bp DNA Ladder (New England Biolabs, UK) were visualised on 2% agarose gel using ethidium bromide ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The AQ-HOXDB_5 PCR product was digested with BssSI-v2 (NEB, R0680L), and the AQ-HOXDB_6 PCR product was digested with NdeI (Thermo Scientific FD0583) ...
-
bioRxiv - Microbiology 2021Quote: ... we treated the PCR reaction with 0.046 μl of Exonuclease I (NEB) and 0.4625 μl of Shrimp alkaline phosphatase (Affymetrix ...
-
bioRxiv - Plant Biology 2021Quote: ... PCR reactions were performed with a High Fidelity Phusion Polymerase (NEB, Germany), using an Mini personal thermal cycler (BioRad).
-
bioRxiv - Neuroscience 2021Quote: ... Libraries were amplified by PCR using the Q5 High Fidelity Polymerase (NEB) for 12 cycles with barcoded primers ...
-
bioRxiv - Neuroscience 2020Quote: ... plus 25 μl NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541L) was added to 20 μl of purified transposed DNA ...
-
bioRxiv - Bioengineering 2021Quote: ... PCR products were purified by gel extraction (Monarch gel extraction kit, NEB), and assembled in a Golden Gate assembly containing 6.25 ng pU6-atgRNA-GG-acceptor (Addgene #132777) ...