Labshake search
Citations for New England Biolabs :
3551 - 3600 of 7434 citations for rno mir 129 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: Routine PCR was performed using Q5 High-fidelity Mastermix (NEB M0492L). PCR purification and gel extraction was performed using Macherey-Nagel Kit cat ...
-
bioRxiv - Microbiology 2023Quote: ... PCR amplifications were performed with Q5 DNA polymerase (NEB, MA, USA) and assembly was performed using the HiFi DNA assembly master mix (NEB) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The repair plasmids were either synthesized by Genscript Inc or by assembling PCR fragments with NEBuilder (New England Biolabs). Typical repair plasmids had homology arms of 500 bp to 1000bp ...
-
bioRxiv - Developmental Biology 2023Quote: ... Clones were screened by PCR on extracted genomic DNA (NEB, T3010L) using the primer pair listed in Supplementary Table 2.
-
bioRxiv - Bioengineering 2023Quote: ... and amplified with standard PCR using Phusion polymerase (New England BioLabs). Purified mutant DNA and linearized plasmid were electroporated into EBY100 yeast ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we used the kit Phusion High-Fidelity PCR (New England, Biolabs), containing Phusion Buffer 1X ...
-
bioRxiv - Genomics 2023Quote: ... The PCR reaction was carried out using 2X LongAmp Taq (NEB) with the following PCR parameters 94°C for 3 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR amplification of edited loci using Q5 polymerase (NEW ENGLAND BIOLABS) with genotyping and NGS primers (Extended Data Table 3) ...
-
bioRxiv - Genetics 2023Quote: ... amplicons were purified using Monarch® PCR & DNA Cleanup Kit (NEB).
-
bioRxiv - Developmental Biology 2023Quote: ... Samples were PCR-amplified (12.5 μL NEBNext High-Fidelity 2× NEB PCR Master Mix ...
-
bioRxiv - Genetics 2023Quote: ... All PCRs were performed using the high-fidelity Q5 polymerase (NEB) as per manufacture instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... followed by PCR using Q5® high-fidelity DNA polymerase (NEB) with specific primers (Table S2) ...
-
bioRxiv - Cell Biology 2023Quote: ... The amplified PCR product was restriction digested using EcoRI/XhoI (NEB). Simultaneously ...
-
bioRxiv - Synthetic Biology 2023Quote: All PCRs were done using Q5 2X Master Mix (NEB, M0492L). Primers were designed on Benchling (https://benchling.com/ ...
-
bioRxiv - Cancer Biology 2023Quote: ... and NEBNext HiFi 2x PCR Master mix (New England Biolabs M0541). The PCR conditions were ...
-
bioRxiv - Genomics 2023Quote: ... Purified PCR products were then treated with Exonuclease I (NEB, M0568L) and purified using 1× AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2023Quote: ... All PCR reactions were performed with Q5 polymerase (New England Biolabs) and cleaned up using Nucleospin Gel and PCR spin columns (Macherey-Nagel) ...
-
bioRxiv - Molecular Biology 2023Quote: ... All PCRs were performed using Q5 High-Fidelity DNA polymerase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and Luna Universal one-step qRT-PCR kit (New England BioLabs) as previously described (13 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Atp10A DNA products were detected via PCR (Q5 DNA Polymerase, NEB) followed by gel electrophoresis ...
-
bioRxiv - Molecular Biology 2023Quote: ... All PCRs were performed using Q5 High-Fidelity Master Mix (NEB). All Gibson assemblies were performed using NEBuilder HiFi DNA Assembly (NEB).
-
bioRxiv - Neuroscience 2023Quote: ... the PCR reaction mixture consisted of 2x Q5 HotStart Mastermix (NEB), 500nM primer-F ...
-
bioRxiv - Genomics 2023Quote: ... using touchdown PCR with Phusion High-Fidelity Polymerase (NEB, no. M0530S) and primers containing partial sequencing adapters (Supplementary Table 6) ...
-
bioRxiv - Immunology 2023Quote: ... 2.5µl Evagreen and 2x Q5 PCR Master mix (NEB, Catalog #50492L) and end point PCR was performed using following program ...
-
bioRxiv - Genomics 2023Quote: ... The PCR reaction was carried out using 2X LongAmp Taq (NEB) with the following PCR parameters 94°C for 3 minutes ...
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR reactions were carried out using Phusion Master Mix from NEB in a final volume of 25 µL for diagnostic PCRs ...
-
bioRxiv - Immunology 2023Quote: ... PCR products were digested with NheI and XhoI (New England Biolabs), gel-purified (Qiagen cat ...
-
bioRxiv - Biochemistry 2023Quote: ... by PCR using Q5 High-Fidelity DNA Polymerase (New England Biolabs, Ipswich ...
-
bioRxiv - Bioengineering 2023Quote: ... elongatus was performed using colony PCR with Q5 DNA Polymerase (NEB), using primer pair NS1_Screen-F/NS1_Screen-R for transformations in neutral site 1 (NS1) ...
-
bioRxiv - Bioengineering 2023Quote: ... and all PCR reactions were performed using Q5 DNA polymerase (NEB).
-
bioRxiv - Cancer Biology 2023Quote: ... PCRs were carried out using High-Fidelity Q5 DNA Polymerase (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted with the Monarch PCR & DNA Cleanup kit (NEB). Sequencing libraries were prepared with the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... the PCR product was treated with 20U of DpnI (R0176L, NEB) for 1 hour at 37°C to eliminate the template ...
-
bioRxiv - Cell Biology 2023Quote: ... fragments were amplified using PCR (NEB Q5 highfidelity DNA polymerase, M0491) from other plasmids or A ...
-
bioRxiv - Genetics 2023Quote: ... which was PCR amplified with Q5 High-Fidelity DNA Polymerase (NEB) using primers that contained 50-nt homology arms to knockout gene locus ...
-
bioRxiv - Immunology 2023Quote: ... Promoter regions were PCR amplified using Q5 polymerase (New England Biolabs) from C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Purified PCR products were 3′A-tailed using Taq polymerase (NEB) and cloned into TOPO TA-cloning vector (Invitrogen) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR was performed using Q5 High Fidelity 2X Master Mix (NEB) with primers purchased from Integrated DNA Technologies (IDT ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR reactions were performed with Q5 polymerase (New England BioLabs, NEB), and the fragments were assembled using HiFi (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR reactions were performed with Q5 polymerase (New England BioLabs, NEB), and the fragments were assembled using HiFi (NEB ...
-
bioRxiv - Systems Biology 2023Quote: ... 25 μL NEBNext Q5 HotStart HiFi PCR Master Mix (NEB, M0543S), and nuclease-free water for a total volume of 50 μL ...
-
bioRxiv - Immunology 2023Quote: ... and amplified with NEBNext High Fidelity PCR Mix (New England Biolabs). Library quality was assessed using a TapeStation instrument ...
-
bioRxiv - Neuroscience 2023Quote: ... 25µL NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs), and 5µL of Nextera i5 and i7 indexed amplification primers (Illumina) ...
-
bioRxiv - Genomics 2023Quote: ... 50 µL NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541S), 2.5 µL STAG_P701_NEX (10 uM) ...
-
bioRxiv - Genomics 2023Quote: ... 50 µL NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541S), 2.5 µL 10 μM STAG_iP7_a1 oligo (5’-CAAGCAGAAGACGGCATACGAGATATTTACCGCAGTGACTGGAGTTCAGACGT*G*T-3’) ...
-
bioRxiv - Plant Biology 2023Quote: ... Purified PCR products were cloned into the pMiniT 2.0 vector (NEB) and transformed into DH10B high-efficiency E ...
-
bioRxiv - Genetics 2023Quote: ... All PCRs were performed using Q5 High-Fidelity DNA Polymerase (NEB). The identity of all plasmids was confirmed by Sanger Sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR product was ligated using T4 ligase (New England Biolabs) and transformed into E ...
-
bioRxiv - Genetics 2023Quote: ... Purified PCR products were then treated with Exonuclease I (NEB M0568L) and purified using 1× AMPure XP beads (Beckman Coulter A63881) ...
-
bioRxiv - Genomics 2023Quote: ... Purified PCR products were then treated with Exonuclease I (NEB, M0568L) and purified using 1× AMPure XP beads (Beckman Coulter ...