Labshake search
Citations for New England Biolabs :
3401 - 3450 of 7437 citations for rno mir 155 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... PCRs were conducted with Phusion according to the manufacturer’s instructions (NEB).
-
bioRxiv - Cell Biology 2020Quote: ... and PCR was done with Q5 High Fidelity DNA polymerase (NEB). The LR reaction kit (Thermofisher Scientific ...
-
bioRxiv - Biophysics 2020Quote: ... The corresponding PCR templates were amplified from λ phage DNA (NEB), with ∼50% GC content ...
-
bioRxiv - Biochemistry 2020Quote: ... Deletion mutants of SETD2 were constructed by PCR (Phusion polymerase, NEB) using full-length SETD2 as a template and individual fragments were cloned ...
-
bioRxiv - Biochemistry 2020Quote: ... Deletion mutants of SETD2 were constructed by PCR (Phusion polymerase, NEB) using full-length SETD2 as a template and individual fragments were cloned ...
-
bioRxiv - Biochemistry 2020Quote: ... PCR amplification was performed in “GC” optimized Pfusion buffer (NEB # M0532S) using a gradient of annealing temperatures and oligonucleotides that anneal only within the unique open reading frame regions of each Lsm locus ...
-
bioRxiv - Developmental Biology 2020Quote: ... Amplification was performed by PCR with Phusion polymerase (New England Biolabs) and TruSeq primers (Sigma) ...
-
bioRxiv - Biophysics 2020Quote: ... was amplified by PCR (M0515, Q5 Hot start, New England Biolabs) to introduce 5’ EcoRI and 3’ XbaI restriction enzyme sites flanking either ends of 3xNLS mScarlet-I sequence (Bindels et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... The hybridized PCR products were digested with T7E1 (New England BioLabs) for 2 h and resolved on 2% agarose gels.
-
bioRxiv - Evolutionary Biology 2020Quote: ... PCR products were gel purified and cloned via Gibson assembly (NEB) into pQCXIP-TRIM5α-HA of the matching species ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was purified using the Monarch PCR & DNA Cleanup Kit (NEB), according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1X Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB), and 400 nM forward and reverse Fluidigm PCR primers in a 20 μL reaction volume ...
-
bioRxiv - Systems Biology 2021Quote: ... PCR amplicons were digested using MfeI-HF and SphI-HF (NEB) and ligated to custom annealed adaptors with PE2 indexing barcodes and phased P1 barcodes (Supplementary file 6) ...
-
bioRxiv - Plant Biology 2021Quote: ... and analyzed by PCR with Taq DNA polymerase (New England Biolabs). NbD14a was amplified with NbD14a,b-F and NbD14a-3’UTR-R primers with the following thermal cycling conditions ...
-
bioRxiv - Microbiology 2020Quote: ... Regions flanking the deletion were PCR amplified with Phusion polymerase (NEB) and cloned directionally into the BamHI site of pLGB36 (49 ...
-
bioRxiv - Microbiology 2021Quote: ... All PCRs were carried out using Q5 High-Fidelity polymerase (NEB). The resulting construct was designed to produce a genomic-sense RNA upon in vitro transcription ...
-
bioRxiv - Microbiology 2021Quote: ... Amplicons were generated by PCR amplification using NEBNext polymerase (NEB #M0541) or AmpliTaq Gold 360 polymerase (ThermoFisher #4398881 ...
-
bioRxiv - Developmental Biology 2020Quote: ... PCR was performed using Taq 2X Master Mix (NEB, Ipswich, MA) with cDNA derived from mosquito whole body as a template ...
-
bioRxiv - Microbiology 2020Quote: ... Digested PCR products were ligated using Quick T4 DNA ligase (NEB) and transformed into E ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR products were then digested with NdeI (New England Biolabs) and BamHI (New England Biolabs ...
-
bioRxiv - Plant Biology 2019Quote: ... The PCR products were assembled by Gibson cloning (New England Biolabs) to give 2×mTurqoise2/pDONR-P2RP3 ...
-
bioRxiv - Cell Biology 2021Quote: ... These homology arms were PCR amplified (Phusion Polymerase, New England Biolabs) from yellow white fly genomic DNA using the primers described below.
-
bioRxiv - Cell Biology 2022Quote: ... and amplified for 15 PCR cycles using Q5 polymerase (NEB, M0491). PCR products were run on a gel ...
-
bioRxiv - Microbiology 2022Quote: ... 25 μL NEBNext High-Fidelity PCR Master Mix (New England Biolabs), 0.5 μM forward and reverse primers ...
-
bioRxiv - Physiology 2022Quote: ... followed by PCR amplification with NEBNext Multiplex Oligos (New England Biolabs). Libraries were quantified with the Qubit High Sensitivity dsDNA Assay (Life Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... PCR of the pilT gene was performed with OneTaq (NEB, M0207) with 500 nM of forward (gatcataatcaatgagcccggtcatgg ...
-
bioRxiv - Genetics 2022Quote: ... The PCR reaction contained 25 μl 2x Q5 DNA Polymerase (NEB), 2.5 μl K1F (10 μM) ...
-
bioRxiv - Genetics 2022Quote: ... The PCR reaction contained 25 μl 2x Q5 DNA Polymerase (NEB), 2.5 μl K2.F (10 μM) ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCRs were performed using Q5 polymerase (New England Biolabs, MA, USA) and the following thermocycler programme 98⍰°C – 1 min ...
-
bioRxiv - Microbiology 2022Quote: ... the amplified PCR products were digested with DpnI (New England BioLabs) for 1 h at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were digested with DpnI (New England Biolabs, Ipswich, MA) before transformation as per the manufacturer’s directions.
-
bioRxiv - Plant Biology 2021Quote: ... The PCR products were treated with DpnI-HF (New England Biolabs). The resultant solution was used for E ...
-
bioRxiv - Developmental Biology 2020Quote: ... the PCR products were phosphorylated using T4 PNK (New England Biolabs) and again purified as described above ...
-
bioRxiv - Plant Biology 2021Quote: ... the PCR products were digested with the restriction enzyme DpnI (NEB) to eliminate the template plasmid ...
-
bioRxiv - Immunology 2020Quote: ... The first PCR was performed using Q5 Hotstart Polymerase HiFi (NEB) in a reaction volume of 25 µl with overhang-extended primers under the following conditions (5 × 65°C ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR products were digested with Hind III-HF (New England Biolabs) for 4 h at 37º C ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 µl NEB-Next High-Fidelity PCR Mix (NEB, cat # M0541S), 5 µl of SYBR Green (Invitrogen™ ...
-
bioRxiv - Systems Biology 2022Quote: ... The DNA templates were PCR amplified using Q5 DNA Polymerase (NEB), purified using the GeneJet PCR Purification Kit (Thermo) ...
-
bioRxiv - Microbiology 2022Quote: ... qRT PCR was performed using Luna Universal qPCR master mix (NEB) as per manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... while colony PCR was carried out using Taq Polymerase (NEB, M0270L). All plasmids were assembled using Gibson Assembly (NEB ...
-
bioRxiv - Synthetic Biology 2020Quote: ... PCR products (250 ng) were incubated with 2U of T7EI (NEB) in 1x NEBuffer 2 for 15 min at 37°C and analyzed by agarose gel electrophoresis ...
-
bioRxiv - Microbiology 2019Quote: ... PCR products were digested with DpnI (New England Biolabs, MA, USA) and purified using the EZNA Cycle Pure Kit ...
-
bioRxiv - Microbiology 2019Quote: ... Following PCR using Q5 DNA-polymerase (New England Biolabs, Ipswich, MA) and the BR_83/BR_84 primer pair ...
-
bioRxiv - Molecular Biology 2019Quote: ... Half of the recovered cDNA was PCR-amplified (Q5 polymerase, NEB) using custom sequence-indexed oligonucleotide primers with the following cycle numbers ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR amplicons were barcoded employing LongAmp Taq (New England BioLabs®). The ends of pooled DNA fragments were repaired employing the NEBNext End repair / dA-tailing Module (New England BioLabs®) ...
-
bioRxiv - Genetics 2019Quote: ... and the hybridized PCR products were digested with T7EN I (NEB) for 15 min and separated with a 2% agarose gel ...
-
bioRxiv - Genomics 2019Quote: ... and 20 μL NEBNext High-Fidelity 2X PCR Master Mix (NEB). Amplification was carried out using the following program ...
-
bioRxiv - Bioengineering 2019Quote: ... PCR products were cloned into Lentiviral vector by Gibson Assembly (NEB) and purified with Agencourt AMPure XP SPRI beads (Beckman Coulter) ...
-
bioRxiv - Genomics 2019Quote: ... NEBNext Q5 Hot Start HiFi PCR Master Mix (New England Biolabs) was used with 0.5 ng input and the primers P5_Seq_Luc_F and P7_Ind_#_Han or P7_In_####_Han ...
-
bioRxiv - Genomics 2019Quote: ... NEBNext Q5 Hot Start HiFi PCR Master Mix (New England Biolabs) was used with 0.5 ng cDNA and the primers P5_Seq_Luc_F and P7_Ind_##_Han ...