Labshake search
Citations for New England Biolabs :
3601 - 3650 of 7437 citations for rno mir 155 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... and amplified with NEBNext High Fidelity PCR Mix (New England Biolabs). Library quality was assessed using a TapeStation instrument ...
-
bioRxiv - Neuroscience 2023Quote: ... 25µL NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs), and 5µL of Nextera i5 and i7 indexed amplification primers (Illumina) ...
-
bioRxiv - Genomics 2023Quote: ... 50 µL NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541S), 2.5 µL STAG_P701_NEX (10 uM) ...
-
bioRxiv - Genomics 2023Quote: ... 50 µL NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541S), 2.5 µL 10 μM STAG_iP7_a1 oligo (5’-CAAGCAGAAGACGGCATACGAGATATTTACCGCAGTGACTGGAGTTCAGACGT*G*T-3’) ...
-
bioRxiv - Plant Biology 2023Quote: ... Purified PCR products were cloned into the pMiniT 2.0 vector (NEB) and transformed into DH10B high-efficiency E ...
-
bioRxiv - Genetics 2023Quote: ... All PCRs were performed using Q5 High-Fidelity DNA Polymerase (NEB). The identity of all plasmids was confirmed by Sanger Sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR product was ligated using T4 ligase (New England Biolabs) and transformed into E ...
-
bioRxiv - Synthetic Biology 2024Quote: ... PCRs were performed with Q5 High-fidelity DNA polymerase (NEB, M0491L) plus GC buffer with the following reaction conditions ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 μL NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541S), 36.9 μL nuclease-free water and 2.5 μL of 10 μM sample index N (10x Genomics ...
-
bioRxiv - Bioengineering 2024Quote: ... All PCRs were performed using Q5 High-Fidelity DNA Polymerase (NEB).
-
bioRxiv - Microbiology 2023Quote: ... PCR amplification was with high-fidelity Phusion polymerase (New England Biolabs). Constructs were verified by colony-PCR using Taq polymerase followed by DNA sequencing (performed by Eurofins-GATC Biotech).
-
bioRxiv - Microbiology 2023Quote: ... PCRs were performed with Hot Start Taq DNA Polymerase (NEB, M0495L). IGR delVG bands were separated on a 2% agarose gel ...
-
bioRxiv - Molecular Biology 2023Quote: ... The resulting PCR product was ligated (T4 Ligase, New England Biolabs) with AhdI-digested (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... Each 20 µL PCR reaction contained 1× OneTaq Master Mix (NEB), 0.2 µM of each primer ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCRs were undertaken using the Q5 High-Fidelity Polymerase kit (NEB) and thermocycling conditions of 98°C ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting PCR product was digested with AgeI and XbaI (NEB) and then ligated into the pattB-13xLexAop2EGFP plasmid (Coutinho-Budd ...
-
bioRxiv - Neuroscience 2023Quote: ... and Sanger sequenced using the NEB PCR Cloning Kit (NEB, #E1202S).
-
bioRxiv - Bioengineering 2023Quote: ... PCRs were performed with Q5 ® High-Fidelity DNA polymerase (NEB). PCR products were confirmed on a 0.8% agarose gel and purified using Wizard® SV Gel and PCR Clean-Up kit (Promega) ...
-
bioRxiv - Molecular Biology 2023Quote: ... usingn Phusion® High-Fidelity PCR Master Mix (New England Biolabs). The target PCR products were mixed with the same volume of 1 × loading buffer (contained SYBR green) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and subjected to library construction PCR using Q5 HF mastermix (NEB), which was size selected using nondenaturing PAGE and recovered by ethanol precipitation ...
-
bioRxiv - Bioengineering 2024Quote: ... PCR reactions were composed of 10 µL Q5 reaction buffer (NEB), 1 µL 10 mM dNTPs (NEB) ...
-
bioRxiv - Biochemistry 2023Quote: ... All PCR steps were carried out using Q5 DNA polymerase (NEB).
-
bioRxiv - Plant Biology 2023Quote: ... PCR amplicons were ligated with AgeI- and XhoI- (New England BioLabs) linearized pEAQ-HT vector27 using HiFi DNA assembly mix (New England BioLabs) ...
-
bioRxiv - Systems Biology 2024Quote: ... followed by purification using a Monarch PCR&DNA Cleanup Kit (NEB). Ring-ligation was carried out using T4 DNA ligase (NEB ...
-
bioRxiv - Genetics 2024Quote: ... PCRs were performed according to manufacturer’s protocol (New England Biolabs, M0273) and PCRs were resolved on agarose gels.
-
bioRxiv - Synthetic Biology 2024Quote: ... 1X Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB), and 400 nM forward and reverse Fluidigm PCR primers in a 20 uL reaction volume ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... PCR was carried out with One Taq DNA polymerase (NEB, cloning) using primers listed in Supplementary Table 5 and products cloned using the pGEM-T Easy Vector System I (Promega ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR was performed on the cDNA samples using Phusion polymerase (NEB). EGFP reactions used HF buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... The PCR products were introduced in pMal-c2 (New England Biolabs) expression vector through FastCloning [34] ...
-
bioRxiv - Plant Biology 2024Quote: ... MpGDI2 (Mp6g05010) and MpNAC7 (Mp6g02620) by PCR using Phusion polymerase (NEB). Arabidopsis Bobber1 (At5g53400 ...
-
bioRxiv - Molecular Biology 2024Quote: PCR amplification was done with NEB Q5 master mix (NEB #M0492), and 34 cycles of amplification ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR fragments were incubated with the T7 Endonuclease I (NEB, M0302S) and nuclease activity was confirmed by DNA agarose electrophoresis.
-
bioRxiv - Biochemistry 2024Quote: ... This PCR was performed using Q5 high-fidelity DNA polymerase (NEB) with the following settings ...
-
bioRxiv - Biochemistry 2024Quote: ... This PCR was performed using Q5 high-fidelity DNA polymerase (NEB) with the following settings ...
-
bioRxiv - Bioengineering 2024Quote: ... PCR was conducted with the Q5® 2X Master Mix (NEB) and ATP6 Sanger sequencing primers (listed in Supplementary Table S4) ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR samples were treated with NEBNext End Repair Module (NEB, E6050) and the adaptor ligated DNA was amplified using NEBNext Q5 Hot Start Hifi PCR Master Mix (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... All cloning PCR products were amplified by Q5 polymerase (NEB, M049L). For construction of vectors used for luciferase assays ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and purified with the Monarch® PCR & DNA Cleanup Kit (NEB). An aliquot (1 µg ...
-
bioRxiv - Microbiology 2024Quote: ... All PCRs were performed using Q5 high-fidelity DNA polymerase (NEB). Plasmids with desired mutation were cloned in Escherichia coli DH5α ...
-
bioRxiv - Microbiology 2024Quote: ... Target genes were amplified by PCR with Phusion DNA polymerase (NEB) using 10 ng C ...
-
bioRxiv - Molecular Biology 2024Quote: ... The gRNA construct was generated by PCR with Phusion polymerase (NEB) and primers SOL897 and SOL898 (see Supplementary Table 4 for primer sequences ...
-
bioRxiv - Plant Biology 2020Quote: A 1.9 kb upstream of the transcription start site ATG of the At1g77960 gene was PCR amplified with RGO-promo-F and RGO-Promo-R primer pairs using Phusion® High-Fidelity DNA Polymerase (New England Biolabs, Whitby, ON, Canada) with Arabidopsis genomic DNA as the template and was verified by DNA sequencing (Eurofins Genomics ...
-
bioRxiv - Microbiology 2021Quote: The rem allele was amplified from a cloning construct (primer sequences in Table S4) and ligated into pTYB12 (NEB IMPACT system of protein purification), resulting in an N-terminal intein fusion to Rem ...
-
bioRxiv - Molecular Biology 2021Quote: ... The gene fragment was amplified from approximately 30ng of DNA in each sample (primers in Supplementary Table 1) using a high-fidelity polymerase (NEB Q5, New England Biolabs)[27] and confirmed by 1% agarose gel electrophoresis ...
-
bioRxiv - Molecular Biology 2021Quote: ... The DNA templates for transcription were obtained by PCR amplification of the psiCheck-2 vectors using a forward primer containing an SP6 promoter sequence by Phusion HF polymerase (NEB, USA, Cat. No. M0530S). After transcription ...
-
bioRxiv - Microbiology 2022Quote: ... from the duplicate wheels for each sample were mixed and the resulting 2.5 µl were amplified either with the 16S- or the ITS-specific primers and Q5® Hot Start High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA, USA). The PCR settings used were as follows ...
-
bioRxiv - Bioengineering 2024Quote: ... gDNA was extracted using full B2M locus primers (Supplement Table 1) and amplified with Q5® Hot Start 2x Master Mix (New England Biolabs, Ipswich, Massachusetts, US). The target DNA was purified by PureLink® PCR cleanup (Invitrogen) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Site directed mutagenesis was then performed for the promoter region of iLight repressor through using NEB Q5® Site-Directed Mutagenesis Kit with non-overlapping primers or NEBuilder® HiFi DNA Assembly (New England BioLabs, MA, USA) with overlapping primers ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 80 ng of RNA of each sample was converted into cDNA using the LunaScript RT SuperMix kit (New England Biolabs, Ipswich, MA, USA). qPCR experiments were performed with the Luna Universal qPCR Master Mix (New England Biolabs ...
-
bioRxiv - Pathology 2021Quote: RT-qPCR was also performed on RNA extracted from the 4 dpi lung samples with NEB Luna Universal One-Step RT-qPCR Kit with SYBR-Green (NEB, Ipswich, MA, USA) to quantify the cytokines IL-6 and IFN-β ...