Labshake search
Citations for New England Biolabs :
3301 - 3350 of 7437 citations for rno mir 155 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... PCR products were purified with a DNA purification kit (NEB) and were then phosphorylated using T4 polynucleotide kinase (NEB ...
-
A modular circuit architecture coordinates the diversification of courtship strategies in DrosophilabioRxiv - Neuroscience 2023Quote: ... were PCR amplified with Q5 High-Fidelity master mix (NEB) and cloned into pCFD4 (Addgene 49411 ...
-
bioRxiv - Genetics 2023Quote: ... PCR on cDNA was performed with Q5 polymerase (NEB, M0491) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: ... we PCR amplified the DNA using Q5 polymerase (NEB, M0491) and Lambda DNA (NEB ...
-
bioRxiv - Genomics 2023Quote: ... All PCR reactions were performed using Q5 polymerase (NEB, M0491). The final indexed and purified DNA was spiked-in for additional sequencing of 5,000 reads per cell.
-
bioRxiv - Molecular Biology 2023Quote: ... 20 µL PCR reaction contained 1× OneTaq Master Mix (NEB), 0.2 µM of each primer ...
-
bioRxiv - Microbiology 2023Quote: ... High-fidelity PCR amplification was performed using Phusion polymerase (NEB), and standard PCR amplification was performed using Taq mix red (PCRBIO) ...
-
bioRxiv - Microbiology 2023Quote: ... All PCR reactions used Q5® High-Fidelity polymerase (NEB) unless otherwise specified ...
-
bioRxiv - Developmental Biology 2023Quote: ... The PCR product was subjected to T4 PNK (NEB M0201S) and T4 DNA ligase (NEB M0202S ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR amplifications were done using Phusion DNA polymerase (NEB, M0530L), following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR was done using Q5 High-Fidelity DNA polymerase (NEB) and Monarch PCR Cleanup Kit (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR products were treated using DpnI (New England Biolabs) and purified using the Wizard SV Gel system and the PCR Clean-Up System (Promega).
-
bioRxiv - Systems Biology 2024Quote: ... The PCR products were digested with DpnI (New England Biolabs) at 37°C for 1 hour to remove the original methylated template ...
-
bioRxiv - Genetics 2024Quote: Histone array PCR amplicons were incubated with PaqCI (NEB #R0745) for 1-3 hours at 37C and subsequently cleaned up with GeneJet PCR clean up kit (Thermo Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR reactions were performed with Q5 polymerase (New England Biolabs) in the buffer provided ...
-
bioRxiv - Biophysics 2024Quote: ... purified using a PCR clean up kit (NEB, Cat# T1030L) and eluted in water ...
-
bioRxiv - Molecular Biology 2024Quote: ... Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB) following the manufacturer’s instruction and specific primers (see primer list) ...
-
bioRxiv - Microbiology 2024Quote: ... Large colonies were screened with colony PCR (Phusion polymerase, NEB) for integration through the 5’ flank using primers P1 and P6 ...
-
bioRxiv - Microbiology 2024Quote: ... All PCR steps were carried out with Phusion polymerase (NEB) using the manufacturer’s guidelines.
-
bioRxiv - Microbiology 2024Quote: ... The PCR product was treated with DpnI (New England Biolabs). All plasmids were transformed into E ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified PCR products were digested with NotI (New England Biolabs) and ligated into pMON721 linearized with NotI to generate the SEGS-1 G ...
-
bioRxiv - Genomics 2024Quote: ... and library amplification using Phusion HF PCR kit (NEB #E0553L).
-
bioRxiv - Synthetic Biology 2024Quote: ... followed by purification with Monarch® PCR & DNA CleanupKit (NEB). Successful DNA assembly was verified first by colony PCR using GoTaq® Green Master Mix (Promega ...
-
bioRxiv - Immunology 2024Quote: ... The products from these PCR reactions were purified (NEB T1030S). The purified products were sent to Eurofins for Sanger sequencing ...
-
bioRxiv - Genomics 2024Quote: ... The PCR products were treated with Exonuclease 1 (NEB, M0293S) to digest single-stranded products ...
-
bioRxiv - Microbiology 2024Quote: ... All PCR-generated probes were treated with exonuclease I (NEB) according to the manufacturer’s protocol to remove single-stranded DNA ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... We used the Monarch PCR and DNA Cleanup Kit (NEB) to purify PCR products ...
-
bioRxiv - Synthetic Biology 2024Quote: ... PCR products were digested with Dpn1 (NEB, Ipswich, MA, USA) to destroy the original template and were purified using the QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Synthetic Biology 2024Quote: ... All reagents for cloning and PCR were purchased from NEB and Fisher Scientific.
-
bioRxiv - Developmental Biology 2021Quote: ... DNA was amplified with 12 cycles of PCR using the NebNext Hi-Fi 2X PCR Master Mix (New England Biolabs Inc, Ipswich, MA, Cat #M0541S). Following PCR ...
-
bioRxiv - Plant Biology 2021Quote: ... cDNA fragments corresponding to the full-length ORFs of the candidate genes were then amplified via PCR with Q5® High-Fidelity Polymerase PCR kit (NEB, Frankfurt am Main, Germany) using gene-specific gateway primers (Supplementary Table S9) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Sheared extracts were adapter-ligated and enriched using the standard NEBNext or NEBNext Ultra protocol (catalog #E6040 and #E7370) and NEBNext multiplex Illumina primers (catalog #E7335) (NEB, Ipswich, MA, USA) in ½-size recommended reaction volumes for end-preparation ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Reverse transcription was performed on 10 μL of RNA using the ProtoScript II Reverse Transcriptase and Random Primer 6 (New England BioLabs, Ipswich, MA, USA) under the following thermal conditions ...
-
bioRxiv - Biophysics 2021Quote: ... or unlabeled anti-sense primers (Eurofins Genomics, Louisville, KY or Integrated DNA Technologies, Coralville, IA, USA) and Taq DNA Polymerase (New England BioLabs, Ipswich, MA, USA).
-
bioRxiv - Synthetic Biology 2021Quote: ... the pKDsg-ack plasmid was amplified with primers pKD1 and IS1noScarFwd as well as pKD2 + IS1noScarRev using Q5 DNA polymerase (New England Biolabs, Ipswitch, MA, USA). Both products were DpnI digested and cleaned with the Viogene Gel/PCR DNA Isolation Kit (Viogene-Biotek Corporation ...
-
bioRxiv - Microbiology 2019Quote: ... Plasmids were amplified with the primer pair F5: CAACAAGCTAGCGTTTGCGAGGCTAAAGGCG / F6: CAACAATCTAGAGGTTCCCACTCCCAAAGC and DNA sequences digested with XbaI and BmtI (NEB, Ipswitch, MA, USA) and ligated ...
-
bioRxiv - Plant Biology 2022Quote: ... Detection of editing in the target genes was performed via amplifying the target regions (primers in Supplemental Table 1) with high fidelity DNA polymerase Q5 (New England Biolabs, Ipswich, MA, USA), followed by cloning of PCR products and sequencing ...
-
bioRxiv - Genomics 2022Quote: ... The extracted RNA was used for library preparation (NEBNext Ultra II RNA Library Prep with Sample Purification Beads, #E7775S) with appropriate barcoded sequencing primers (NEB #E7335-12 indices).
-
bioRxiv - Microbiology 2020Quote: ... amplified with the primers Dhm1275-1 and −2 (Table 2) using a NEBuilder HiFi DNA Assembly Kit (New England BioLabs, Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2019Quote: ... The qPCR analyses were conducted with 5 μL of the reverse transcription reaction mixture with gene-specific primers (Supplementary Table S1) and the Luna Universal qPCR Master Mix (New England Biolabs, Ipswich, MA, USA) was used ...
-
bioRxiv - Developmental Biology 2020Quote: ... we amplified PCR fragments with the respective primers containing the gRNA sequences (Table S1) and utilizing Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs, Cat. No: M0494L). After gel-purification of the PCR fragments with the QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Plant Biology 2021Quote: ... Detection of editing in the EBE region of CsLOB1 promoter was performed by amplifying the target region (primers in Supplementary Table 3) with high fidelity DNA polymerase Q5 (New England Biolabs, Ipswich, MA, USA), followed by cloning of PCR products and sequencing.
-
bioRxiv - Neuroscience 2020Quote: ... the first-strand of cDNA was synthesized using a random hexamer primer and M-MuLV reverse transcriptase (RNase H-) (New England BioLabs, Ipswish, MA, USA). Next ...
-
Cryo-EM reveals disrupted human p97 allosteric activation by disease mutations and inhibitor bindingbioRxiv - Biochemistry 2021Quote: ... c.1774G>A (D592N) (see Table S1 for full list of primer sequences) using the Q5® Site-directed mutagenesis kit (New England Biolabs, MA, USA). Each mutant sequence was verified for insertion of the correct mutation using sanger sequencing.
-
bioRxiv - Genomics 2021Quote: ... Primers were design using NEBuilder assembly tool to have 20-basepair (bp) homology arm overhangs for Gibson cloning (36)(NEB, Cat. No. E2611) into the pPB-βlacZ vector digested with SpeI and SacII for 3’ cloning ...
-
bioRxiv - Genomics 2021Quote: ... Amplification was performed following bisulfite conversion using primers from the NEBNext Multiplex Oligos for Illumina module (cat#: E7535L, New England BioLabs, Ipswich, MA, USA) and the Kapa HiFi Uracil+ PCR system (cat# ...
-
bioRxiv - Microbiology 2023Quote: ... was amplified from JE2 using the primer pair 3810/9647 and the snap-tag coding sequence amplified from pSNAP-tag (T7)-2 (New England Biolabs, NEB; Supplementary Information) using the primer pair 9631/9632 ...
-
bioRxiv - Systems Biology 2023Quote: ... First-strand cDNA was subsequently synthesized using random hexamer primer and M-MuLV reverse transcriptase (RNase H-) (New England BioLabs, Ipswich, MA, USA). Next ...
-
bioRxiv - Physiology 2023Quote: ... 300nmol-L of a gene specific primer (thermofisher scientific, USA) and 10uL of Syber green qPCR mastermix (New England Biolabs, Ipswich, Massachusetts, USA) each used as per manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2024Quote: For the PCR enrichment of adapter-ligated DNA the forward and reverse primer were already combined and NEBNext Multiplex Oligos (New England Biolabs GmbH, Frankfurt, Germany) for Illumina Set 1 to 3 were used as dual index primer pairs in a PCR with 15 cycles according to the manufacturer’s protocol ...