Labshake search
Citations for New England Biolabs :
251 - 300 of 3671 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... The enzyme pair HinfI and HpyCH4IV (New England Biolabs, Ipswich, USA) was selected based on the number of fragments ...
-
bioRxiv - Molecular Biology 2022Quote: qPCR was performed using the Luna qPCR mix (NEB) to measure the relative amount of origin DNA compared to the terminus ...
-
bioRxiv - Molecular Biology 2022Quote: qPCR was performed using the Luna qPCR mix (NEB) to measure the amount of genomic loci bound to DnaA ...
-
bioRxiv - Molecular Biology 2022Quote: qPCR was performed using the Luna qPCR mix (NEB) to measure the relative amount of origin DNA compared to the terminus ...
-
bioRxiv - Molecular Biology 2022Quote: qPCR was performed using the Luna qPCR mix (NEB) to measure the amount of genomic loci bound to DnaA ...
-
bioRxiv - Microbiology 2024Quote: qPCR was performed using the Luna qPCR mix (NEB) to measure the relative amount of origin DNA compared to the terminus ...
-
bioRxiv - Cell Biology 2021Quote: ... ORF was amplified from MCF10A human mammary cells using specific primers (listed in Table S2) with Q5 High-Fidelity 2X Master Mix (New England BioLabs, # M0492), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... and Illumina linker addition to B cell heavy chain transcripts were performed using the human heavy chain only primers of NEBNext Immune Sequencing Kit (New England Biolabs #E6320) according to the manufacturer’s instructions (provided upon request) ...
-
bioRxiv - Genomics 2021Quote: ... a 5’ adenylated DNA oligonucleotide containing the complement of an Illumina Read 1 sequencing primer-binding site was then ligated to the 3’ cDNA end with Thermostable 5’ AppDNA / RNA Ligase (New England Biolabs). Properly ligated cDNAs were amplified by PCR (12 cycles ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Flanking primers contain 20 bp of 5’ and 3’ overlap with the pcDNA3.1 vector for Gibson Assembly (New England Biolabs, #E5510). The resulting library had an estimated complexity of 322 = 1024 codon variants and 202 = 400 amino acid variants ...
-
bioRxiv - Synthetic Biology 2022Quote: ... or PCR amplified using primers that anneal to the 5’ or 3’ ends of each chunk with Phusion polymerase (New England Biolabs). Plasmid digested or PCR amplified chunks were excised from agarose gels or column purified ...
-
bioRxiv - Microbiology 2022Quote: ... the pulL gene was PCR-amplified from plasmid pCHAP8258 as template using primers PulL Kpn 5 and PulL Eco 3 with the high-fidelity Q5 DNA polymerase (New England Biolabs). The PCR products were purified on a Qiaquick spin column ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...
-
bioRxiv - Molecular Biology 2024Quote: ... the double-stranded (ds) cDNA was PCR amplified with primers directed against 5’ and 3’ RNA cassettes and NEB Q5 HotStart polymerase (NEB). To introduce unique barcodes secondary PCR was performed using TrueSeq primers (NEB ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-ACG CGT ACT AGT CGA TCG CTT GTA CAG CTC GTC CAT G-3’ (reverse primer) and using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and primers listed in (Extended Data Table 3) and used for in vitro transcription by T7 RNA polymerase (New England Biolabs). Resulting RNA was purified using a spin-column kit (RNeasy mini kit ...
-
bioRxiv - Plant Biology 2023Quote: ... Promoters and 3’ UTRs were amplified from Col-0 genomic DNA using the primers listed in (Supp Table 3) with Q5 Hot Start High-fidelity DNA polymerase (NEB). For MBD5 and SUVH3 ...
-
bioRxiv - Biochemistry 2024Quote: ... cDNA was PCR amplified using the primers directed against 5′ and 3′ RNA cassettes and NEB Q5 HotStart polymerase (NEB). To introduce unique barcodes ...
-
bioRxiv - Genomics 2024Quote: ... The backbones for the Gibson reaction for GRB2-SH3 and PSD95-PDZ3 library assembly (aPCA plasmids) were first linearized using primers listed in Extended Data Table 3 and next treated with Dpn1 (NEB) restriction enzyme to remove the circular plasmid template ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Illumina sequencing libraries were prepared by amplifying 50 µL of each cDNA sample with sequencing adapters (500 nM each library amplification primer, Supplementary Table 3) using the NEBNext Q5 High Fidelity 2x PCR Kit (NEB) under the following cycling conditions ...
-
bioRxiv - Biochemistry 2024Quote: Cas13a Alcr open reading frames were amplified with T7 forward and reverse primers (Supplementary Table 3) using 2X Q5 polymerase Master Mix (NEB) and purified with QiaQuick PCR clean up (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... coli (NEB 10-beta electrocompetent cells, New England BioLabs C3020K) and plated at a target bottleneck of 50,000 variants per duplicate library ...
-
bioRxiv - Genomics 2022Quote: ... The product was transformed into 10-beta Electrocompetent E.coli (NEB), by electroporation with 2.0kV ...
-
bioRxiv - Microbiology 2022Quote: ... coli (NEB 10-beta electrocompetent cells, New England BioLabs C3020K) and plated at a target bottleneck of 100,000 variants per duplicate library ...
-
bioRxiv - Immunology 2022Quote: ... coli (NEB 10-beta electrocompetent cells, New England BioLabs #C3020K), and bottlenecked to ∼1 × 105 cfus (an average of >25 barcodes per single-mutant) ...
-
bioRxiv - Immunology 2024Quote: ... we electroporated 100 µl of NEB 10-beta (NEB, #C3020K) in a BioRad electroporator using the preset E ...
-
bioRxiv - Synthetic Biology 2024Quote: ... commercial 10-beta competent cells (New England Biolabs, Ipswitch, MA) were transformed with plasmids carrying a canvas repeat sequence-targeting sgRNA cassette driven by strong constitutive promoter apFAB36 [21] ...
-
bioRxiv - Genomics 2023Quote: ... followed by transformation into 10-beta competent cells (NEB, C3020) using the Gemini X2 machine (BTX) ...
-
bioRxiv - Genetics 2024Quote: ... and then transformed into 10-beta competent cells (NEB, C3020) via electroporation ...
-
bioRxiv - Bioengineering 2020Quote: ... each forward/reverse oligo pair was annealed in T4 Ligation Buffer (NEB), with T4 PNK to phosphorylate the oligos ...
-
bioRxiv - Genomics 2020Quote: Each oligos pair was further phosphorylated and annealed using T4 PNK (NEB) and T4 Ligation Buffer (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Annealed sgRNA oligo pairs were phosphorylated with T4 PNK (NEB, USA #M0201S) and ligated with Quick Ligase (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... specific i7 and i5 NEBNext index pairs (5uM) (New England Biolabs, U.S) were added to each sample and incubated as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... and DNA fragments were amplified by PCR with NEXTFlex primers (Primer 1 - 5’-AATGATACGGCGACCACCGAGATCTACAC; Primer 2 - 5’-CAAGCAGAAGACGGCATACGAGAT) and Phusion High-Fidelity DNA Polymerase (NEB) and further purified with AMPure XP beads to eliminate unligated primers and adapters ...
-
bioRxiv - Cell Biology 2021Quote: ... Libraries were amplified by PCR using NextFlex PCR primers (Primer 1 - 5’-AATGATACGGCGACCACCGAGATCTACAC; Primer 2 - 5’-CAAGCAGAAGACGGCATACGAGAT) and Phusion High-Fidelity DNA Polymerase (NEB) before three further rounds of AMPure XP purification were performed to collect fragments 150-300 bp in size ...
-
bioRxiv - Plant Biology 2021Quote: ... qPCR was performed using Kapa SYBR FAST qPCR Master Mix or Luna Universal qPCR Master Mix (NEB) on a QuantStudio 3 system ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR was performed in 20 µL reactions using Luna qPCR Universal qPCR Master Mix (New England Biolabs), 5 ng of cDNA as template ...
-
bioRxiv - Microbiology 2023Quote: ... Primers were designed with the NEB primer design tool (New England Biolabs).
-
bioRxiv - Genomics 2023Quote: ... Universal PCR Primer for Illumina and index primer for Illumina (NEB E7335S), and 2X Kapa HiFi HotStart ReadyMix (Kapa KK2611) ...
-
bioRxiv - Genomics 2023Quote: ... Universal PCR Primer for Illumina and index primer for Illumina (NEB E7335S), and 2X Kapa HiFi HotStart ReadyMix (Kapa KK2611) ...
-
bioRxiv - Genetics 2022Quote: ... pipientis infection status by qPCR (NEB Luna Universal qPCR kit) using primer sets for wsp and arm (S1 Table) ...
-
bioRxiv - Immunology 2022Quote: ... RT-qPCR was performed with Luna Universal qPCR reagent (NEB). eMLV env was detected with 5’-AGGCTGTTCCAGAGATTGTG-3’ and 5’-TTCTGGACCACCACATGAC-3’ and 18S rRNA was detected with 5’-GTAACCCGTTGAACCCCATT-3’ and 5’-CCATCCAATCGGTAGTAGCG-3’ on Roche LightCycler 480 II (104,105).
-
bioRxiv - Plant Biology 2024Quote: ... qPCRs were done using qPCR Master Mix (NEB, M3003, www.neb.com) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... qPCR was performed using Luna Universal qPCR Master Mix (NEB) with Bio-Rad iQ5 multicolor real-time PCR detection system ...
-
bioRxiv - Immunology 2023Quote: ... qPCR was performed using Luna universal QPCR mix (NEB # M3003) in the CFX96 Real-Time PCR system with a C1000 Thermal Cycler (Bio-Rad) ...
-
bioRxiv - Systems Biology 2024Quote: ... qPCR was performed using Luna qPCR master mix (NEB, M3004).
-
bioRxiv - Genetics 2024Quote: ... qPCR was performed with LUNA qPCR MasterMix (NEB Cat# M3003) on a QuantStudio 3 Real-Time PCR System (Fisher Cat# A28566 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... qPCR was conducted using the Luna qPCR Master Mix (NEB), with two technical replicates per cDNA sample ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... and BGH reverse (5’-TAG AAG GCA CAG TCG AGG -3’) primers from the pcDNA3.1+/-C-(K)-D vector using standard methods (NEB 2x Q5) which include 5-10 ng DNA per reaction ...