Labshake search
Citations for New England Biolabs :
501 - 550 of 3671 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... RT-qPCR was performed by using Luna Universal One-Step RT-qPCR reagents (New England Biolabs). Primers targeting the MS2 stem-loop regions were used for quantifying repeat RNA expression levels ...
-
bioRxiv - Immunology 2020Quote: ... Real time qPCR was performed using the Luna Universal Probe One-Step RT-qPCR Kit (NEB) run on a QuantStudio 3 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Biochemistry 2020Quote: ... and qPCR performed using the SYBR Green Luna® Universal qPCR Master Mix (NEB, USA, M3003) on the QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems™ ...
-
bioRxiv - Immunology 2021Quote: ... RT-qPCR was performed using Luna® Universal One-Step RT-qPCR Kit (New England Biolabs), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... RT-qPCR reactions were performed using Luna® Universal qPCR Master Mix (New England Biolabs #M3003). Primers for qPCR reactions are shown in Table 1 ...
-
bioRxiv - Plant Biology 2022Quote: ... qPCR was performed using the Luna Universal qPCR Master Mix (New England Biolabs Japan, Tokyo, Japan) on a QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2024Quote: ... RT-qPCR was performed in technical triplicates using the Luna® Universal qPCR Master Mix (NEB) in a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR was then performed using Luna Universal One-step RT-qPCR kit (New England Biolabs) following the provided protocol on a BioRad CFX Opus 96 quantitative Real-Time PCR machine ...
-
bioRxiv - Immunology 2023Quote: Reverse transcriptase qPCR was performed using Luna Universal Probe One-Step RT-qPCR Kit (NEB, # E3006L). The following predesigned primers and probe sets for each target and the housekeeping gene GAPDH were purchased from IDT:
-
bioRxiv - Developmental Biology 2023Quote: ... RT-qPCR was performed with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) according to manufacturer’s instruction on an iQ5 Real-Time PCR System (Bio-Rad) ...
-
bioRxiv - Neuroscience 2023Quote: ... RT-qPCR was performed by using Luna Universal One-Step RT-qPCR reagents (New England Biolabs), following the manufacturer’s instructions.
-
bioRxiv - Zoology 2024Quote: ... RT-qPCR was performed using the Luna One-step RT-qPCR kit (New England Biolabs, Germany) on a 384 well-plate with 3 technical replicates per biological replicate in CFX384 Touch Real-Time PCR (Bio-Rad ...
-
bioRxiv - Developmental Biology 2024Quote: ... Each qPCR reaction mixture contained 5 µL 2x Luna Universal qPCR master mix (New England BioLabs), 1 µL cDNA (2-fold dilution) ...
-
bioRxiv - Microbiology 2024Quote: ... probe-based qPCR was carried out using Luna Universal Probe qPCR Master Mix (New England Biolabs) and the QuantStudio3 Real-Time PCR System (Thermo Fisher ...
-
bioRxiv - Bioengineering 2024Quote: qPCR was performed using the Luna® universal qPCR master mix (M3003, New England Biolabs, UK) following the manufacturer’s protocol on a StepOnePlus qPCR instrument (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2022Quote: ... Luna Universal qPCR Master Mix (NEB) was used to amplify the DNA fragment ...
-
bioRxiv - Developmental Biology 2022Quote: Luna Universal qPCR Master Mix (NEB) was used to amplify 1.5 µl of each cDNA sample in a 20 µl total reaction using the manufacturer’s standard protocol on an Applied Biosystems StepOne Real-Time PCR System (Thermo) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Luna Universal qPCR Master Mix (NEB), and the primers listed in supplementary table S1 ...
-
bioRxiv - Immunology 2020Quote: ... with Luna Universal qPCR Mastermix (NEB). For analysis of Aicda mRNA decay ...
-
bioRxiv - Developmental Biology 2024Quote: ... Luna Universal qPCR Master Mix (NEB) was used to amplify 2.0 microliters of each cDNA sample in a 20 microliter total reaction using the standard protocol on an Applied Biosystems StepOne Real-Time PCR system (Thermo) ...
-
bioRxiv - Microbiology 2024Quote: ... qPCR reactions used Taq polymerase (NEB) and EvaGreen (Biotium ...
-
bioRxiv - Genomics 2020Quote: ... were combined with RT primer mix [1 μl 250 ng/μl randomhexRT primer and 0.5 μl 10 mM dNTPs (NEB)] ...
-
bioRxiv - Biochemistry 2021Quote: ... 0.1 μg cDNA was added to a 50 μl Q5 Hot Start High-Fidelity DNA Polymerase PCR reaction with 0.2 μM each of NEBNext SR Primer for Illumina and NEBNext Index Primer for Illumina (NEB) and run for 6 cycles with a 15 s 62 °C extension step ...
-
bioRxiv - Systems Biology 2021Quote: ... the beads were used to amplify libraries using 13 cycles of PCR with the Illumina Forward PE1.0 primer and Illumina Reverse indexed primer (New England Biolabs) in the presence of Kapa HiFi HS DNA Polymerase (Kapa Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: ... and cutting efficiency of each pair was assessed by monitoring the loss of either FokI (NEB R0109) or HphI (NEB R0158 ...
-
bioRxiv - Molecular Biology 2020Quote: ... New spacers were then cloned into the arrays by phosphorylation of oligo pairs with T4 PNK (NEB), hybridization of the oligo pair ...
-
bioRxiv - Zoology 2023Quote: ... The amplified products were measured using a 100 base pair (bp) DNA ladder (New England Biolabs Inc.) at specific bands corresponding to their base pairs for the two bacterial species.
-
bioRxiv - Molecular Biology 2023Quote: ... or ClaI and PacI restriction sites pairs of CircRNA Mini Vector by restriction digestion (New England Biolabs) and DNA ligation using T4 DNA Ligase (New England Biolabs).
-
bioRxiv - Microbiology 2024Quote: ... 700 base pairs upstream and downstream of region to be deleted were PCR amplified (Phusion®, NEB) and inserted into the suicide vector pEXG2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were recovered in 1 ml NEB® 10-beta/Stable Outgrowth Medium (NEB, B9035) at 37 °C for 1 hour ...
-
bioRxiv - Immunology 2020Quote: ... transferred to 42°C and digested by immediate addition of 2ul of beta-agaraseI (NEB) per 300ul of melted gel and incubation at 42°C for 1h ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... transformations that involved the CRE library were performed using electroporation (NEB 10-beta electrocompetent E.coli), in all other cloning steps chemically competent E ...
-
bioRxiv - Biochemistry 2024Quote: ... Purified products were again transformed into either NEB 10-beta (New England Biolabs, Ipswich, MA) or SIG10 (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... The cosmid-I95 plasmid was amplified in a NEB 10-beta (New England Biolabs, C3019H), and the DNA was purified using a QIAfilter Plasmid Midi Kit (Qiagen ...
-
bioRxiv - Synthetic Biology 2023Quote: ... according to manufacturer’s protocols and transforming chemically competent NEB 10-beta cells (NEB CN# C3019), where colony PCR and Sanger sequencing were again used to determine if the clone was correct.
-
bioRxiv - Cancer Biology 2024Quote: ... Six electroporations of the bead-purified ligations were performed into NEB10-beta E.coli cells (NEB® 10-beta Electrocompetent E ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... We transformed the purified HiFi reaction into 10-beta electrocompetent cells (NEB, Cat. No. C3020K) with a BioRad MicroPulser Electroporator (Cat ...
-
bioRxiv - Neuroscience 2021Quote: ... qPCR reactions were performed in 20μl total volume with Luna Universal qPCR Master Mix (New England Biolabs). Target genes and reference controls were analysed in duplicate reactions for all samples ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed using Luna® Universal One-Step RT-qPCR kit (New England Biolabs; #E3005L). Briefly ...
-
bioRxiv - Microbiology 2021Quote: ... 20 μL qPCR reactions were prepared using the LUNA® Universal qPCR Master Mix (New England Biolabs), together with 2.5 μL of ChIP DNA (1:10 ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using the Luna universal one-step RT-qPCR kit (#E3005, New England Biolabs) according to the provided protocol ...
-
bioRxiv - Molecular Biology 2023Quote: RT-qPCR experiments were performed with the Luna® Universal One-Step RT-qPCR Kit (NEB, #E3005E) with a final reaction volume of 10 μL per well ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-qPCR was performed using the Luna® SARS-CoV-2 RT-qPCR Multiplex Assay Kit (NEB) with the CDC-derived primers for N1 and N2 gene targets and the reaction was performed using the QuantStudio™ 5 System (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2024Quote: ... qPCR was conducted using NEB Luna Universal qPCR Mastermix following manufacturer recommendations and cycling conditions (NEB, M3003).
-
bioRxiv - Genetics 2024Quote: ... RT-qPCR reactions were carried out using the Luna Universal One-Step RT-qPCR Kit (NEB, #E3005L). Quantification was performed using a SYBR Green-based method on an Eppendorf Realplex Mastercycler (software version 2.2.0.84) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... this region was amplified using 10 separate pools of 33 nt primers containing NNN in the middle of the primer and using Gibson Assembly Master Mix (NEB) was cloned into pNL4-3 rev-in-nef after digesting by BamHI and XhoI ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was PCR-amplified for 25 cycles with 5’-Cy3-labelled reverse primers (IDT) and unlabeled forward primers using either Taq polymerase or Phusion high-fidelity polymerase (NEB). PCR products were separated on 40cm tall 6% polyacrylamide denaturing gels and then visualized using a Molecular Dynamics Typhoon Scanner ...
-
bioRxiv - Microbiology 2021Quote: ... All mutant plasmids were generated using the Q5 site-directed mutagenesis kit using PAGE-purified mutagenesis primers designed using the online NEBase Changer primer design tool (New England BioLabs). The mCherry plasmid was created by cloning mCherry into the multiple cloning site of pTriEx-3 (Novagen ...
-
bioRxiv - Plant Biology 2020Quote: First amplification was done in 20 μL with DegPstI (degenerated primers) and Rb1 (on the aphVIII cassette) primers with Taq polymerase (NEB) using 58°C annealing temperature for 5 cycles ...
-
bioRxiv - Cell Biology 2022Quote: ... The 229E Spike cDNA was amplified by PCR with the forward primer: 5’-TTTTTTGCGGCTAGCATGTTCGTGCTGCTGG and the reverse primer: 5’-TTTTTTGCGCTCGAGTCACGCCGGCGCCACCTGGCTGGTTTCGGTCTGGATGTGGATC TTTTCCA using Phusion polymerase (New England Biolabs) according to manufacturer’s instruction ...