Labshake search
Citations for New England Biolabs :
151 - 200 of 3671 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... Embryos were genotyped by sequencing PCR products using primer vangl2 fwd 5’-ATTCCCTGGAGCCCTGCGGGAC-3’ and primer vangl2 rev 5’-AGCGCGTCCACCAGCGACACAGC-3’ or restriction digest of the PCR products with Alu1 (R0137S, NEB). The vangl2 wild type allele stayed intact while the vangl2vu67 mutant allele was identified by a digested PCR product.
-
bioRxiv - Cell Biology 2024Quote: ... siRNA resistant mCherry-ALG-2 was created by mutagenesis (primers sequences 5’-ATTTCGATGTTTGACCGTGAGAAC-3’, 5’-AATGGACCTGACAGTCACTGGATTAAA-3’) using a Q5 Site-Directed Mutagenesis Kit (E0554S, NEB). The plasmid encoding IST1-GFP is as described (63 ...
-
bioRxiv - Developmental Biology 2023Quote: The myo1g ORF was amplified from mixed stage pool of cDNAs using primers 5’-GATCCCATCGATTCGATGGCGGAGCTGGAGGGCTTG-3’ and 5’-AGGCTCGAGAGGCCTTACTGGGGCAGGAGTAAGG-3’ and cloned into the pCS2+ vector using Gibson assembly mix (NEB). Bold letters in the primer sequences indicate Gibson overhangs that are also present in the pCS2+ sequence ...
-
bioRxiv - Neuroscience 2024Quote: ... The UNC13A CE was amplified with a forward primer in exon 19 5’-CAGACGATCATTGAGGTGCG-3’and reverse primer in exon 22 5’-ATACTTGGAGGAGAGGCAGG-3’using Q5 High Fidelity Master Mix (NEB). PCR products were resolved on a TapeStation 4200 (Agilent ...
-
bioRxiv - Developmental Biology 2024Quote: ... pax9el622 fish were genotyped using primers F3 (5’-TCGGAACAGGTCAGAATAGGA-3’) and R3 (5’-TCGGAACAGGTCAGAATAGGA-3’) and Bsrl digestion (New England Biolabs), producing digested wild-type bands (611 and 186 bp ...
-
bioRxiv - Genomics 2022Quote: ... Barcoding and enrichment of libraries was carried out using NEBNext® Multiplex Oligos for Illumina® (96 Unique Dual Index Primer Pairs; New England Biolabs, Cat. No. E6440). Paired-end sequencing (2×151bp reads ...
-
bioRxiv - Synthetic Biology 2020Quote: ... This was done in 50 μl reactions using 3 μl dual index primers (NEB), 135 ng purified PCR product from the previous reaction and 25 μl Q5 high fidelity master mix (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... cDNAs and primers (listed in Table 4) were mixed with Luna Universal qPCR Master mix (New England Biolabs) and amplification was carried out in duplicate in a CFX96 Real-Time System C1000 Touch Thermal Cycler (Bio-Rad ...
-
bioRxiv - Genetics 2024Quote: ... 0.5 µl of each primer (10 µM) and 12.5 µl Luna Universal Probe qPCR Master Mix (NEB, M3004) were mixed in a final volume of 25 µl ...
-
bioRxiv - Genetics 2021Quote: ... pUASTattB-3xHA::amxFL described above was used as a template to amplify and add appropriate homology arms to the SS-3xHA::Amx DNA sequence with the primers 5’- CCCCGCTCTATCTGACCAAAGCCACCATGAGGCTCCAACGAC-3’ and 5’- AAAACTAAACTAAGAACGGACTACTATATGTAAAGTGAGCCATCCGC-3’ using Q5® High-Fidelity 2X Master Mix (M0492S, NEB). The section of pattB-amx plasmid containing the amx regulatory elements was linearized by PCR using Q5 polymerase and primers 5’- CGTTGGAGCCTCATGGTGGCTTTGGTCAGATAGAGCG-3’ and 5’- GCTCACTTTACATATAGTAGTCCGTTCTTAGTTTAGTTTTACAGGGGT-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... E1E2 sequence was amplified via PCR from pcDNA E1E2 vector using primers (forward 5’ CGAAGCTTGCATGGGTTGCTCTTTC 3’. and reverse 5’ CAGAATTCCCGCCTCCGC 3’) the product was subsequently digested with HindIII and EcoRI (NEB, USA) and ligated into pEGFP-N1 to create a E1E2-EGFP fusion construct with EGFP at the C-terminal end.
-
bioRxiv - Genomics 2023Quote: ... using 0.3 μM of dual-indices primers (forward: 5’:AATGATACGGCGACCACCGAGATCTACACCTCCAAGTTCACACTC TTTCCCTACACGACGCTCTTCCGATCT-3’; reverse 5’-CAAGCAGAAGACGGCATACGAG ATCGAAGTATACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTAGCAAACTGGGG CACAAGC-3’) and amplified using Q5 2X master mix (NEB #M0541S) according to the following protocol ...
-
bioRxiv - Microbiology 2022Quote: Libraries cloned in the pYD1 vector were amplified using forward 5’-TTAAGCTTCTGCAGGCTAGTGGTG-3’ and reverse 5’-CACTGTTGTTATCAGATCAGCGGG-3’ primers with Taq DNA Polymerase and ThermoPol Buffer (New England Biolabs Ltd) for 16 cycles of 95°C for 30 sec ...
-
bioRxiv - Bioengineering 2024Quote: ... This strategy avoids 3’-terminal editing of the mismatched primers by the 3’-5’ exonuclease activity of Q5® High-Fidelity DNA Polymerase (NEB), increasing PCR specificity.61
-
bioRxiv - Molecular Biology 2021Quote: ... Oligonucleotide pairs were phosphorylated and annealed by mixing 100 pmol of each pair and 0.5 μL T4 PNK (NEB) then incubated at 37°C for 30 minutes ...
-
bioRxiv - Pathology 2022Quote: ... A targeting vector with P2A-CreERT2-T2A-GFP-stop codon-rabbit beta globin polyA sequence flanked by 5’ and 3’ homology arms was generated using NEBuilder HiFi DNA Assembly (NEB) and cloned into a pKO2 backbone plasmid ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... coli DH10-beta (New England Biolabs) was transformed with Gibson assembly product ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl beta-agarase (NEB M0392S) was added and mixed by flicking without allowing sample to cool ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli DH10-beta competent cells (NEB); approximately 50 single colonies were picked ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli NEB 10-beta (C3020K, NEB). For the rest of the workflow the strain was switched back to TOP10 ...
-
bioRxiv - Genomics 2020Quote: ... coli 10 betas (New England Biolabs) were used as the evolution host and 2 ...
-
bioRxiv - Plant Biology 2024Quote: ... coli strain NEB10 beta electromax (NEB) was used as bacterial host ...
-
bioRxiv - Systems Biology 2024Quote: ... and NEBNext Multiplex Oligos for Illumina Index Primers Set 1 and 3 (NEB E7335S, E7710S) and PCR-amplified for 15 cycles ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was PCR amplified using primers: 5’-gaagaaatgaatttgccagg-3’ and 5’-ctcatgttcttcttgggc-3’ and Phusion DNA Polymerase Master mix (New England Biolabs, Ipswich, MA). DNA was sent for Sanger Sequencing to check for reversion mutations.
-
bioRxiv - Plant Biology 2022Quote: The pVecBar-Rht13 construct contained a 6,998 bp fragment including 2,532 bp upstream and 450 bp downstream regions amplified from Magnif mutant genomic DNA using primers Rht13-NotF2 (5’ AATGCGGCCGCAATCGATAGGAGAGCTGCGTCTGTGTG 3’) and Rht13-AscR2 (5’ TGCGTACGGCGCGCCGAGAGTCGCCTTGCCAGTTC 3’) with Phusion® High-Fidelity DNA Polymerase (NEB, USA). pVecBarIII is a derivative of pWBvec8 (Wang et al. ...
-
bioRxiv - Biophysics 2024Quote: ... The mutation of S328A of HtrA1 and its Protease domain were created using primers 5’-CTATGGAAACgcgGGAGGCCCGT-3’ and 5’-TTGATGATGGCGTCGGTCTG-3’ with a NEB Q5® Site-Directed Mutagenesis Kit (New England Biolabs, MA). The PCR protocol was as followed ...
-
bioRxiv - Genetics 2024Quote: ... using cDNA as template along with gene-specific primers (Table S2) and Luna SYBR Green qPCR master mix (NEB), following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Restriction digestions were performed in a 60 ml volume with 1200 ng of DNA and 4–4.5 ml restriction enzyme(s) (Chr1 hotspot pair: NsiI, NcoI, and BglII or NcoI alone; Chr19 hotspot pair: BamHI or KpnI; BioLabs). Reactions were incubated overnight at 37 °C followed by an additional 3 h of incubation with a 1.5–2 ml of fresh restriction enzyme(s) ...
-
bioRxiv - Neuroscience 2020Quote: ... with TdTomato was amplified by PCR with primers (5’- ggcgcgCCCCCCTCTCCCTCCCCCCC -3’ and 5’- ggcgcgccTTACTTGTACAGCTCGTCCATGCCGTACAG -3’) using Hot start Q5® polymerase (NEB, Frankfurt, Germany) from LeGO-iT (a gift from Boris Fehse ...
-
bioRxiv - Plant Biology 2022Quote: ... and a NEBNext Multiplex Oligos for Illumina (Index Primers Set 3) (Code E7710; New England Biolabs) according to the manufacturer’s instructions ...
-
Epigenetic deregulation of IFN and WNT pathways in AT2 cells impairs alveolar regeneration (in COPD)bioRxiv - Cell Biology 2023Quote: ... Dual-indexing was carried out with the TruSeq panel of indexing primers in a short-cycle PCR using Luna Universal Probe One-Step RT-qPCR reagents (NEB). The pooled adapter libraries were purified and size-selected using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2024Quote: ... primers listed in Table S1) was performed using One step Luna Universal RT-qPCR kit (New England Biolabs, Ipswich, MA) using an Applied Biosystems QuantStudio 3 (Thermofisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... qPCR was run with primers targeting specific genes (Table S1 and Table S2) and Luna Universal qPCR Master Mix (New England Biolabs) at the Bio-Rad CFX96 Real-Time PCR system (Bio-Rad) ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... coli DH 10-beta (New England Biolabs) was transformed with Gibson assembly product ...
-
bioRxiv - Developmental Biology 2022Quote: ... coli strain 10-beta (New England Biolabs) or TOP10 (Invitrogen) ...
-
bioRxiv - Bioengineering 2023Quote: ... Escherichia coli 10-beta (New England Biolabs) was used for plasmid construction ...
-
bioRxiv - Bioengineering 2023Quote: ... NEB 10-beta (NEB cat. no. C3019), or NEB Stable (NEB cat ...
-
bioRxiv - Microbiology 2023Quote: ... coli NEB beta cells (New England BioLabs) and verified by Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... coli NEB beta cells (New England BioLabs) and verified by Sanger sequencing ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli NEB10 beta was obtained from NEB. Cells are grown in LB media supplemented with Erythromycin (E6376 Sigma-Aldrich ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli 10-beta cells (New England Biolabs) with 5 μl of the assembly mix according to the protocol provided by the manufacturer ...
-
bioRxiv - Plant Biology 2024Quote: ... coli cloning strain 10-beta (NEB # C3019H). E ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15 µL 10x T4 ligase buffer, 3 µL 50 mg/mL BSA, 1.5 µL 2000U/µL T4 ligase, NEB, 6 µL BLISS adapter pairs). For removal of excess adapters ...
-
bioRxiv - Neuroscience 2024Quote: ... Reverse: 5’-GCTGCCAGTCCAATAGAGGG-3’) were used with the Luna Universal One-Step RT-qPCR Kit (NEB) with SYBR Green detection on the CFX96 (Bio-Rad ...
-
bioRxiv - Bioengineering 2021Quote: ... qRT-PCR was performed with primers specific for target genes (see Supplementary Table 1 for the list of primers) using the Luna universal One-Step RT-qPCR kit (NEB; E3005). Experiment was performed using the QuantStudio3 (Applied Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... qRTPCR was performed with primers mentioned in Table S3 with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs). Log2 normalized RNA abundances were calculated using ValidPrime signal as reference (51).
-
bioRxiv - Cell Biology 2022Quote: ... Expression profiles of the genes listed below were analyzed with the specified primers using Luna® Universal qPCR Master Mix (NEB). Quantitative RT-PCR was performed using StepOnePlus (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... Yields of viral RNA were quantified by real-time qPCR by using SARS-CoV-2 specific primers targeting the E gene with the Luna®Universal One-Step RT-qPCR Kit (New England Biolabs) in a LightCycler 480 thermocycler (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... Quantification is based on real-time SYBR green amplification molecules with specific target primers using Luna® Universal qPCR Master Mix (Biolabs). Relative mRNA expression is calculated using the CFX Manager software (Bio-Rad) ...
-
bioRxiv - Cell Biology 2022Quote: ... were incubated with 25 μL of containing TF or 18S primers and fluorescent Luna® Universal qPCR Master Mix (New England Biolabs), and qRT-PCR was carried out in triplicate for each sample on the CFX Connect real-time System (Bio-Rad Laboratories).