Labshake search
Citations for New England Biolabs :
101 - 150 of 3671 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... and Calnexin (membrane) using qPCR primers (IDT) with Q5 polymerase (New England Biolabs, M0492) was measured with a highly sensitive dsDNA detection dye (Lumiprobe ...
-
bioRxiv - Neuroscience 2020Quote: ... GCaMP6s was cloned by PCR from pK152 with primer pairs LW010/LW011 and was ligated into SalI/EcoRV site of pK068 vectors by using NEBuilder (New England BioLabs: E5520S). For pK326 ...
-
bioRxiv - Microbiology 2020Quote: ... and indexed with the NEBNext Multiplex Oligos for Illumina 96 Unique Dual Index Primer Pairs (New England Biolabs, Part Number E6442S). Libraries were sequenced on Illumina’s NextSeq 550 System (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... 66 and 51 bp fragments were amplified by PCR using as template the cDNA obtained from infected Arabidopsis plants with designated primer pairs introducing EcoRI at the N-terminal and XhoI (NEB, CAD) at the C-terminal end (Table S1) ...
-
bioRxiv - Biochemistry 2020Quote: ... Variable regions of transcripts were PCR-amplified for 35 cycles using high-specificity primer pairs designed to minimize cross-hybridization between CaMKII genes (Supplementary table XX) using either Phusion polymerase (NEB #M0530) or KAPA HiFi polymerase (Roche) ...
-
bioRxiv - Microbiology 2022Quote: ... pKVS45-tifA ablated ToxN-site was constructed via round-the-horn PCR on pKVS45-tifA using the primer pairs SS-33/34 followed by Gibson Assembly using the 2x HiFi DNA Assembly Master Mix (NEB E2621). TifA codons were recoded using Geneious and ordered as a gene-block fragment from IDT (with 46 of 85 codons recoded with 55 nucleotide changes ...
-
bioRxiv - Neuroscience 2023Quote: ... PCRs to confirm targeted and untargeted SMN2 loci were performed for each of the cell lines with primer pairs shown in table 1 using High-Fidelity 2X PCR Master Mix (NEB, M0541L) and Thermal Cycler C1000 Touch (Bio-RAD) ...
-
bioRxiv - Genomics 2023Quote: ... DNA fragments were further size-selected by agarose gel elution and PCR amplified for 6 to 8 cycles using Illumina P1 and Index primer pair and Phusion® High-Fidelity PCR Master Mix (New England Biolabs). The final library was purified using Agencourt AMPure XP beads and quality assessed by Agilent Bioanalyzer 2100 (DNA 7500 kit ...
-
bioRxiv - Systems Biology 2023Quote: ... The first round was performed with primer pairs listed in Supplementary Table S7 with 16 cycles using NEBNext High Fidelity Master Mix (NEB, # M0541) for the screens with EpiC and Tiling libraries and NEBNext Ultra II Q5 Master Mix (NEB ...
-
bioRxiv - Systems Biology 2023Quote: We amplified the synthesized oligo library using the following primer pair GGCTTTATATATCTTGTGGAAAGGACGAAACACCG (Forward) and CTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC (Reverse) with NEBNext High-Fidelity Master Mix (NEB, #M0531) for 10 cycles ...
-
bioRxiv - Microbiology 2024Quote: ... and utilized for library constructions with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina along with NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs; NEB; # E7760L). The libraries were sequenced on the NovaSeq platform as paired-end reads using the S1 v1.5 kit with 300 cycles (Illumina) ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Microbiology 2024Quote: ... MBTUni-13 primer (5’-ACGCGTGATCAGTAGAAACAAGG-3’) and Phusion Polymerase (NEB M0530L). PCR products were purified with PureLink PCR Purification Kit (Invitrogen K310002 ...
-
bioRxiv - Genetics 2021Quote: ... using the LTP library preparation kit and employing NEBNext multiplex oligos for Illumina index primer pairs set 1 (New England Biolabs, Ipswich, Massachusetts). Sequencing was performed using a NextSeq 500/550 mid-output v2.5 300 cycle cartridge (Illumina ...
-
bioRxiv - Plant Biology 2023Quote: ... The up- and downstream flanks were obtained by PCR on gDNA of IPO323 with primer pairs 1&2 and 5&6 (Table S7) respectively using Q5 Hot Start High fidelity DNA polymerase (NEB, Evry, France). The hph was amplified from pCAMBIA0380 with the primers 3 and 4 (Table S7) ...
-
bioRxiv - Microbiology 2023Quote: ... was amplified from JE2 using the primer pair 3810/9647 and the snap-tag coding sequence amplified from pSNAP-tag (T7)-2 (New England Biolabs, NEB; Supplementary Information) using the primer pair 9631/9632 ...
-
bioRxiv - Immunology 2024Quote: ... Samples were processed using the NEBNext Ultra-II RNA library prep kit from New England Biolabs (cat # E7775S) and the NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer pairs) (NEB, cat # E6440S) according to manufacturer’s protocol.
-
bioRxiv - Systems Biology 2024Quote: ... pC1-TagBFP-DAO-KDEL was amplified using the 86-87 pair of primers and the obtained fragment was digested with the XbaI/BamHI (NEB, R0145/R0136) pair of endonucleases along with pLVX-Puro-DAAD and then ligated ...
-
bioRxiv - Immunology 2024Quote: ... as per the manufacturer’s recommendations and indexed using NEBNext® Multiplex Oligos for Illumina® (96 Unique Dual Index Primer Pairs) (NEB #E6440S). Final libraries were analyzed using Agilent’s Bioanalyzer system (Agilent High Sensitivity DNA Kit Cat #50674626 ...
-
bioRxiv - Biochemistry 2021Quote: ... 1000 base pairs upstream and downstream from the C-terminus of clpP1 were amplified by PCR using the A–B and C–D primer pairs from Table 2 (Phusion polymerase, GC buffer, New England Biolabs, Ipswich, United States). For clpP2 ...
-
bioRxiv - Microbiology 2023Quote: ... was amplified from JE2 using the primer pair 3810/9647 and the snap-tag coding sequence amplified from pSNAP-tag (T7)-2 (New England Biolabs, NEB; Supplementary Information) using the primer pair 9631/9632 ...
-
bioRxiv - Cell Biology 2024Quote: ... by linearizing the vector with 15 base pairs (bp) overlapped primers using Phusion high-fidelity DNA polymerase (New England Biolabs, cat. no. MO531L). PCR products were digested using Dpn I (Takara ...
-
bioRxiv - Developmental Biology 2024Quote: ... The adaptor-ligated material was PCR amplified with 14 cycles using the NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs) (NEB, Cat. No. E6442S) and the indexed libraries were purified using SPRIselect at 0.9X with the Mosquito HV and eluted in 10 µL of 0.1X TE.
-
bioRxiv - Synthetic Biology 2024Quote: ... The kanR site was then amplified through PCR using the primer pair HBo-314 and HBo-315 and the Q5® High-Fidelity 2X Master Mix (NEB, Cat. # M0492L) for 25 cycles ...
-
bioRxiv - Genomics 2024Quote: ... using four specific primer pairs (Table S2) with overlapping amplicon regions and Phusion Hot Start Flex Master Mix (New England Biolabs, NEB, Ipswich, MA, USA). After AMpure XP beads (Beckman Coulter ...
-
bioRxiv - Genomics 2024Quote: ... Library enrichment was carried out using NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs; New England Biolabs; Cat. No. E6440) or NEBNext Multiplex Oligos for Illumina (Unique Dual Index UMI Adaptors RNA Set 1 ...
-
bioRxiv - Genomics 2024Quote: ... Adaptor ligated DNA was amplified for 12 cycles using NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs; New England Biolabs; Cat. No. E6440) and cleaned up with 0.7× volume of AMPure XP Reagent (Beckman Coulter ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli 10-beta (NEB) cells using a Zymo Miniprep kit according to the supplier’s instructions ...
-
bioRxiv - Biophysics 2024Quote: ... coli beta-10 (NEB) colonies expressing either mEos4b ...
-
bioRxiv - Immunology 2020Quote: ... and the ratio of viral genome: human gDNA were estimated using qPCR via Luna Universal qPCR Master Mix (New England Biolabs) using designed primers Gag-Fwd ...
-
bioRxiv - Microbiology 2021Quote: ... the template and primers were added to a Luna Universal qPCR Master Mix (New England BioLabs) and reactions were performed on a 7500 Fast Real-Time PCR system (Life Technologies ...
-
bioRxiv - Physiology 2023Quote: ... using Luna Universal qPCR master mix for Sybr Green primers (New England Biolabs, Cat. No. M3003X). All primer sequences are listed in Supplementary Table 1 ...
-
bioRxiv - Cell Biology 2021Quote: The entry vector pDONR223 containing the full-length GRN (1–1179 base pairs) from the human orfeome collection was used to engineer a stop codon by site-directed mutagenesis (New England Biolabs) at the end of the open-reading frame sequence (ORF) ...
-
bioRxiv - Plant Biology 2020Quote: A 1.9 kb upstream of the transcription start site ATG of the At1g77960 gene was PCR amplified with RGO-promo-F and RGO-Promo-R primer pairs using Phusion® High-Fidelity DNA Polymerase (New England Biolabs, Whitby, ON, Canada) with Arabidopsis genomic DNA as the template and was verified by DNA sequencing (Eurofins Genomics ...
-
bioRxiv - Genomics 2024Quote: ... using four specific primer pairs (Table S2) with overlapping amplicon regions and Phusion Hot Start Flex Master Mix (New England Biolabs, NEB, Ipswich, MA, USA). After AMpure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2022Quote: ... Next the 3’ primer regions were truncated using the BciVI restriction endonuclease (NEB), followed by 2.0x AMPure XP cleanup ...
-
bioRxiv - Developmental Biology 2024Quote: ... and the NEBNext Multiplex Oligos from Illumina (Index Primers Set 1, 2, 3 and 4, NEB, E7335S, E7500S, E7710S, E7730S), following the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.2 μM reverse primer and 5 μL Luna® Universal Probe qPCR Master Mix (New England Biolabs)] amplified using the Prism7900HT sequence detection system (Applied Biosystems ...
-
bioRxiv - Physiology 2023Quote: ... using either Luna Universal qPCR master mix for Sybr Green primers (New England Biolabs, Cat. No. M3003X) or Taqman Fast Advanced Master mix (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... coli (10-beta, NEB, C3020K) were thawed on ice and mixed with 6 µg of purified 3Cs-DNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli cells (NEB 10-beta). The recombinant N-terminal His6-tagged TrxA protein encoded by slr0623 was expressed and purified as previously described previously for His-tagged proteins (Lapina et al ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli 10-beta (NEB C3020) cells ...
-
bioRxiv - Biochemistry 2021Quote: ... E.coli (NEB® 10-beta) containing both a Cas effector and gRNA plasmid (Table S3 ...
-
bioRxiv - Bioengineering 2023Quote: ... 10-beta cells (NEB #C3020K) or TOP10 (Invitrogen #C404010 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and beta-agarase (NEB, M0392L). Melted plugs were equilibrated to 0.3 M NaCl concentration ...
-
bioRxiv - Biophysics 2024Quote: ... coli 10-beta cells (NEB). Instead ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 10-beta (NEB # C3019H). For vectors containing the ccdB/CmR cassette ...
-
bioRxiv - Microbiology 2021Quote: 16S rRNA gene regions V3-V4 were amplified with primers 314F (5’-CCTAYGGGRBGCASCAG-’3) and 806R (5’-GGACTACNNGGGTATCTAAT-3’) with Phusion High-Fidelity PCR Master mix (New England Biolabs) and amplified products were verified using Agilent 5400 Fragment analyser ...
-
bioRxiv - Molecular Biology 2024Quote: ... The CHD4-GFP mutant was cloned with selective primers (fwd, 5’-GGATGCTACAGGTGGAACCCTGCACCCCTA-3’; rev, 5’-GCCCAGGCCCGACGCCAT-3’) and a Q5 site-directed mutagenesis kit (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... Embryos were genotyped by sequencing PCR products using primer vangl2 fwd 5’-ATTCCCTGGAGCCCTGCGGGAC-3’ and primer vangl2 rev 5’-AGCGCGTCCACCAGCGACACAGC-3’ or restriction digest of the PCR products with Alu1 (R0137S, NEB). The vangl2 wild type allele stayed intact while the vangl2vu67 mutant allele was identified by a digested PCR product.