Labshake search
Citations for New England Biolabs :
51 - 100 of 3671 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... and the NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs) (NEB, Cat. No. E6440S) and purified using the SPRIselect bead-based reagent (Beckman Coulter ...
-
bioRxiv - Microbiology 2024Quote: ... in combination with NEBNext multiplex oligos for Illumina (96 Unique Dual Index Primer Pairs; New England BioLabs) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... Adaptor-ligated DNA fragments were amplified using NEBNext Unique Dual Index Primer Pairs (New England BioLabs, E6441A) with NEBNext Ultra II Q5 Master Mix (M0544S ...
-
bioRxiv - Microbiology 2024Quote: ... using a specific primer pair (Supplementary table 1) and Q5 High-Fidelity DNA Polymerase (New England Biolabs). The PCR product was purified using a MinElute Reaction Cleanup kit (Qiagen) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and the NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs) (NEB, Cat. No. E6440S) and purified using the SPRIselect bead-based reagent (Beckman Coulter ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... the libraries were indexed using NEBNext Multiplex Oligos for Illumina 96 Unique Dual Index Primer Pairs (NEB). The prepared libraries were quantified via a fluorometric method involving Qubit High Sensitivity (Invitrogen ...
-
Fluoroquinolone-Specific Resistance Trajectories in E. coli and their Dependence on the SOS-ResponsebioRxiv - Microbiology 2024Quote: ... in combination with NEBNext multiplex oligos for Illumina (96 Unique Dual Index Primer Pairs; New England BioLabs). The samples were sequenced using a NextSeq 500/550 Mid Output V2.5 kit (Illumina).
-
bioRxiv - Neuroscience 2024Quote: ... Adaptor-ligated DNA fragments were amplified using NEBNext Unique Dual Index Primer Pairs (E6441A, New England BioLabs) with NEBNext Ultra II Q5 Master Mix (M0544S ...
-
bioRxiv - Genetics 2024Quote: ... and the NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs) (NEB, Cat. No. E6440S) and purified using the SPRIselect bead-based reagent (Beckman Coulter ...
-
bioRxiv - Genetics 2022Quote: ... was assessed via PCR amplification using OneTaq 2x Master Mix (forward primer DLO1142 5’-ACCCATTTCCCATTCAATCA-3’ reverse primer DLO1143 5’-TTGTAATCTGCCCCAAAAGG-3’) and subsequent HpaII restriction digest (New England Biolabs). DLW135 carried a wild type allele of pho-9 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Half-hairpin sequences were amplified from the genomic DNA (common forward primers 5′- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTCTTGTGGAAAGGACGA-3′ and reverse primer 5′-CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCTACTATTCTTTCCCCTGCACTGT-3′) using Q5 High-Fidelity 2x Master Mix (NEB). PCR reactions were cleaned up using Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 ng of DNA was used per qPCR reaction (qPCR Master Mix, NEB). PCR was performed using an Applied Biosystems 7500 instrument (software version 2.3) ...
-
bioRxiv - Cell Biology 2022Quote: ... we used three pairs of specific primers (Supplementary Table S2) with Q5 High Fidelity DNA Polymerase (NEB, M0491) or Phusion High Fidelity DNA Polymerase (Thermo Scientific Inc F530S) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The level 0 acceptor plasmid was amplified with the primer pair SLo0765/SLo0766 using Q5 DNA Polymerase (NEB) followed by a DpnI (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... Index Primers Sets 3 and 4 (New England Biolabs). Libraries were sequenced on an Ilumina NextSeq500 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and No Template Controls (NTC) for each primer pair using Luna Universal qCPR Master Mix (NEB, Ipswich, MA, #M3003) following the manufacturer’s protocol (1ul cDNA ...
-
bioRxiv - Microbiology 2021Quote: ... together with the Bakt_314F (CCTACGGGNGGCWGCAG) and Bakt_805R (GACTACGVGGGTATCTAATCC)38 PCR primer pair with an individual 8 bp barcode adapter (based on the NEB Multiplex Oligos for Illumina ...
-
bioRxiv - Biochemistry 2020Quote: ... was constructed by assembling two fragments amplified from pON106 using two primer pairs (NeoRH1 and P5_A5_reverse, P5_A5_forward and NeoRH2) with Gibson Assembly Master Mix (New England Biolabs, Ipswich, MA, USA). Plasmid No ...
-
bioRxiv - Bioengineering 2023Quote: ... NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs) (Catalog # E6440, NEW ENGLAND BIOLABS,MASSACHUSETTS, UNITED STATES) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR was performed using unique dual index primer pairs (NEBNext Multiplex Oligos for Illumina from New England BioLabs, # E6440S) according the following parameters ...
-
bioRxiv - Cancer Biology 2023Quote: ... Two pairs of primers were used to perform PCR amplification with Q5 High-Fidelity 2X Master Mix (NEB, #M0492S). All validation primers are listed in Supplementary Table 3 ...
-
bioRxiv - Genomics 2022Quote: ... mRNA Magnetic Isolation Module and NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs) following the manufacturer’s description (New England Biolabs).
-
bioRxiv - Microbiology 2021Quote: ... and TMPRSS2 (Forward Primer: CAAGTGCTCCRACTCTGGGAT, Reverse Primer: AACACACCGRTTCTCGTCCTC) were quantified using the Luna Universal qPCR Master Mix (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was mixed with gene-specific primers and subjected to RT-qPCR using Hot Start Taq-based Luna qPCR master mix (NEB). The reaction was run on a Bio-Rad CFX Real Time PCR system ...
-
bioRxiv - Cell Biology 2023Quote: ... Viral RNA quantification was performed by RT-qPCR using the IP4 set of primers and probe and the Luna Universal Probe One-Step RT-qPCR Kit (NEB). Serial dilutions of a titrated viral stock were analyzed simultaneously to express viral loads as eqPFU per gram of tissue.
-
bioRxiv - Plant Biology 2022Quote: ... For quantitative PCR 90 ng of template DNA was used in 10 μl qPCR reactions with 0.25 μM primers and Luna qPCR Master Mix (NEB, USA). qPCR was performed in a LightCycler 480 (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was quantified by qPCR using NEBNext universal and index primers (NEB E7335S). Libraries were indexed using NEBNext High-Fidelity PCR Master Mix (NEB M0541S ...
-
bioRxiv - Genetics 2021Quote: ... Multiple DNA samples were barcoded with unique dual indices using the NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs) (New England Biolabs) and pooled at equimolar concentrations ...
-
bioRxiv - Evolutionary Biology 2021Quote: We amplified pMini with different primer pairs for each mutation to be engineered (Table S5) using high fidelity Q5 polymerase (NEB). We transformed the PCR products into E.coli BW27784 cells made transformation-competent with the CaCl2 method60 ...
-
bioRxiv - Microbiology 2021Quote: ... and Bakt_805R (GACTACGVGGGTATCTAATCC)38 PCR primer pair with an individual 8 bp barcode adapter (based on the NEB Multiplex Oligos for Illumina, New England Biolabs) attached to the forward primer and the reverse primer ...
-
bioRxiv - Biochemistry 2021Quote: ... 700 bp upstream and downstream were amplified using the A–B and C–CD primer pairs from Table 2 (Phusion polymerase, GC buffer, New England Biolabs). The 2×myc tag was added to the B primers as overhangs ...
-
bioRxiv - Biochemistry 2021Quote: ... Primer pairs were cloned by double digestion using SacI and SalI restriction enzymes (R0156, R0156, CutSmart Buffer, New England Biolabs) and ligation with T4 DNA Ligase (EL0014 ...
-
bioRxiv - Cancer Biology 2021Quote: ... vector to generate the LGALS1 luciferase reporter gene (LGALS1 pGL4.23) by digesting the plasmid and the annealed primer pair using EcoRV (NEB, #R0195L) and HindIII (NEB ...
-
bioRxiv - Genomics 2022Quote: ... The three primer pairs were pooled in a multiplex PCR reaction using the Q5 High-Fidelity DNA Polymerase (New England Biolabs) in a 25 μL final volume as follows ...
-
bioRxiv - Microbiology 2023Quote: ... was constructed by PCR amplification of the mCTX2-PexoT-ZTP-lacZ plasmid using the three GA primer pairs (Table 1) followed by NEBuilder assembly (NEB). The resulting PexoT-ZTP(M4)-lacZ reporter fusion was integrated in the P ...
-
bioRxiv - Microbiology 2023Quote: ... in combination with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina and NEBNext Multiplex Oligos for Illumina (Unique Dual Index Primer Pairs) (New England BioLabs). The resulting libraries were subjected to sequencing on a NextSeq 550 Sequencing System (Illumina ...
-
bioRxiv - Genetics 2024Quote: QF2-T2A-LexA-GAD ORF PCR-amplified with FRT-QF2-fwd + FRT-lexA-GAD-rev primer pair – used Hot-Start Q5 polymerase with GC enhancer (NEB);
-
bioRxiv - Microbiology 2024Quote: ... Four PCR fragments of around 2,700 nucleotides long were generated from cDNA using primer pairs (Suppl. Table S2) with NEB Q5 Hot-Start high-fidelity 2× Master Mix (New England Biolabs). Fragments were gel-purified with MinElute gel extraction Kit (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... Vector pET16b and gene mksB (cg3103) were amplified using primer pair MG093/MG094 and MG095/MG096 respectively and cloned using the Gibson Assembly Mastermix (NEB), resulting in plasmid pMG004 ...
-
bioRxiv - Plant Biology 2023Quote: ... and amplified using NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 2, New England Biolabs, #E6442). After quality check with the Bioanalyzer High Sensitivity DNA assay (Agilent) ...
-
bioRxiv - Genomics 2024Quote: Double-stranded DNA libraries were prepared with NEBNext Ultra II DNA Library Prep Kit for Illumina and NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs) (New England Biolab: NEB). Around 1 ng of DNA was used for each library ...
-
bioRxiv - Developmental Biology 2024Quote: ... E14.5 mouse brain cDNA amplified with primers pairs XR293-XR296 and cloned into pCAG-HF-IRES-EGFP by Gibson Assembly (NEB).
-
bioRxiv - Developmental Biology 2024Quote: ... E14.5 mouse brain complementary DNA (cDNA) was amplified with primers pairs XR293-XR294 and cloned into pCAG-HF-IRES-EGFP by Gibson Assembly (NEB).
-
bioRxiv - Developmental Biology 2024Quote: ... the mutations in the Rbfox3 binding motifs were created by amplifying genomic DNA of Neuro2a cells with primer pairs XR301-XR304 and XR303-XR302 and cloned into pCAG-HF-IRES-EGFP by Gibson Assembly (NEB).
-
bioRxiv - Developmental Biology 2024Quote: ... genomic DNA of Neuro2a cells was amplified with primer pairs XR301-XR302 and inserted to pCAG-HF-IRES-EGFP by Gibson Assembly (NEB).
-
bioRxiv - Biochemistry 2024Quote: ... The site-directed mutagenesis was performed using a pair of partially overlapping primers and Phusion DNA polymerase (New England Biolabs) [20] ...
-
bioRxiv - Microbiology 2022Quote: ... and 0.17 μL of random primers (3 mg/mL NEB) in a total volume of 5.25 μL ...
-
bioRxiv - Genetics 2023Quote: The yeast plasmids recovered after thermoselection were subject to a shortened PCR with 15 cycles with oligonucleotide pairs oWS1408 (5°-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCAGCATATAATCCCTGCTTTA-3°) and oWS1409 (5°-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTCCAGGGGTGGTGCAAACTATG-3°) using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA) to attach overhang sequences ...
-
bioRxiv - Biochemistry 2023Quote: ... and “frq segment 4F” (5’-CACCGATCTTTCAGGAGACCCTG-3’) and “frq segment 4R” (5’-CACTCAGGTC TCAATGGTGA TG-3’) pair with pCB05 digested with FseI (NEB, Catalog # R0588S) and MluI (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... The variable region V3+V4 of the 16S rRNA gene was amplified using a broad-range primer pair (338F: 5’-ACTCCTACGGGAGGCAGCA-3′, 806R:5′-GGACTACHVGGGTWTCTAAT-3′) using the Phusionâ High-Fidelity PCR Master Mix (New England Biolabs, Beverley, MA). The PCR amplification program was as follows ...