Labshake search
Citations for New England Biolabs :
2601 - 2650 of 6440 citations for Type 1 Angiotensin II Receptor AGTR1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... and used to generate sequencing libraries using the NEBNext Ultra II FS Library Prep kit (New England Biolabs, Ipswich, MA, USA), followed by sequencing on the Illumina MiSeq platform to generate 250 bp paired end reads ...
-
bioRxiv - Neuroscience 2024Quote: ... 100 ng of total RNA from each sample was used for preparing the libraries with the NEBNext Ultra II Directional RNA Library Prep kit (New England Biolabs, #E7760), using the rRNA depletion module ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2.5 uL each 10 uM forward and reverse primers (cTF254, cTF255) and 25 uL NEBNext Ultra II Q5 Master Mix (NEB, M0544) and ran the following thermocycling protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2.5 uL each 10 uM forward and reverse primers (cTF256, cTF257) and 25 uL NEBNext Ultra II Q5 Master Mix (NEB, M0544) and ran the following thermocycling protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries for small DNA fragments (25-75 bp) were prepared based on the NEBNext Ultra II DNA library prep Kit for Illumina (NEB#E7645).
-
bioRxiv - Molecular Biology 2024Quote: ... The purified cDNA was converted to double stranded DNA (dsDNA) by performing second strand synthesis with NEBNext Ultra II Non-Directional RNA Second Strand Synthesis Module (NEB, E6112) in 20 µl reaction volume for 2.5Lh at 16L°C and 20 min at 65L°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 50 ng of material was fragmented for 8 min at 37 °C and A-tailed for 30 min at 65 °C using NEBNext Ultra II FS DNA Library Prep Kit (NEB, E7805S). The fragmented and dA-tailed DNA library was ligated to dsDNA adapter having both forward (Ligation FWD primer ...
-
bioRxiv - Neuroscience 2024Quote: RNA-seq libraries were prepared from 100 ng RNA/sample using the NEBNext Ultra II RNA library preparation kit for Illumina (NEB E7770S) in conjunction with the NEBNext poly(A ...
-
bioRxiv - Developmental Biology 2024Quote: ... Purified RNAs were used for Illumina RNA-seq library preparation with NEBNext Ultra II Directional RNA Library Prep Kit (NEB; E7765), and a minimum of 20 million raw reads were obtained ...
-
bioRxiv - Cell Biology 2024Quote: ... Qualified RNA samples were subjected to sequencing library construction using the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB, E7775). Paired-end (2 × 150 bp ...
-
bioRxiv - Plant Biology 2023Quote: ... DNA libraries were prepared using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (New England Biolabs) and each individual library was barcoded using the NEBNext® Multiplex Oligos for Illumina® kit (New England Biolabs).
-
bioRxiv - Immunology 2024Quote: ... Libraries were prepared at the according to manufacturer’s instructions for the NEBNext Ultra II Direction RNA kit (NEB, product number E7760). The resulting libraries tagged with unique dual indices were checked for size and quality using the Agilent High Sensitivity DNA Kit (Agilent) ...
-
bioRxiv - Developmental Biology 2024Quote: ... mRNA Magnetic Isolation Module (E7490L) and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (E7760L, New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Developmental Biology 2024Quote: ... and PCR amplification to prepare cDNA libraries using the NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs, USA). Library preparation and next-generation sequencing were outsourced to Rhelixa Inc ...
-
bioRxiv - Genomics 2023Quote: Immuno-precipitated DNA samples at an input amount of 2-100 ng were subjected to Illumina fragment library preparation using the NEBnext Ultra II DNA library preparation chemistry (New England Biolabs, E7370L). In brief ...
-
bioRxiv - Genomics 2023Quote: ... DNA libraries for Next Generation Sequencing were prepared with NEBNext Ultra II RNA Library Prep Kit for Illumina (New England BioLabs E7775) and NEBNext Multiplex Oligos for Illumina (Unique Dual Index UMI Adaptors RNA Set 1 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... four sequencing libraries were generated by NEBNext® Ultra ™II DNA Library Prep Kit for Illumina ® (NEB, Ipswich, MA). Sizes and concentrations of the sequencing libraries were again verified by the Agilent 2100 Bioanalyzer ...
-
bioRxiv - Genomics 2024Quote: ... libraries were prepared in quadruplicate from 1ug DNA using the NEBNext® Ultra II ligation kit (New England Biolabs, Ipswitch, MA) according to the manufacturer’s protocols ...
-
bioRxiv - Genomics 2024Quote: ... was mixed with 1.75 μl of Ultra II End-prep Reaction Buffer and 1.5 μl of Ultra II End-prep Enzyme Mix (cat # E7546, New England Biolabs MA, USA) and incubated at 20°C for 5 min ...
-
bioRxiv - Genetics 2023Quote: ... oligonucleotide pools were amplified by 8 to 10 cycles of PCR using NEBNext Ultra II Q5 Master Mix (New England Biolabs, M0544X), digested with BstXI and BlpI ...
-
bioRxiv - Immunology 2024Quote: ... Sample preparation was performed according to the protocol “NEBNext Ultra II Directional RNA Library Prep Kit for Illumina” (NEB #E7760S/L). Briefly ...
-
bioRxiv - Biochemistry 2024Quote: ... library indexing was carried out with the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs, Cat. E7645S) and sequenced on a NextSeq 1000 P2 cartridge (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by PCR amplification of the BC-sgRNA1-sgRNA2 region from 32 μg of bulk lung genomic DNA using Q5 Ultra II High-Fidelity 2× Master Mix (New England Biolabs, M0494X). Unique dual-indexed primers were used to amplify each sample followed by purification using Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2024Quote: ChIP-seq libraries were prepared independently from two ChIP biological replicates using the NEBNext Ultra II DNA Library Prep Kit (New England Biolabs, #E6177L) according to manufacturer’s instructions with a few modifications ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA-seq libraries were prepared using the NEBNext Ultra II RNA Library Prep Kit for Illumina (New England Biolabs, no. E7775) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 ng of purified CUT&RUN enriched DNA was used to prepare Illumina library using the NEBNext Ultra II DNA Library Prep kit (NEB, #E76450) per the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA-sequencing libraries were prepared using the NEBNext® Ultra™ II Directional RNA Library Prep kit for Illumina® (NEB) following supplier’s recommendations ...
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were prepped with the NEBNext Ultra II Directional RNA library Prep with Poly(A) isolation (New England Biolabs, Ipswich, MA). Reads were aligned to the mouse genome using Elysium ...
-
bioRxiv - Microbiology 2023Quote: ... RNA-seq libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, NEB) using 200-600ng total RNA as input ...
-
bioRxiv - Molecular Biology 2024Quote: ... libraries were constructed with the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (catalog no. E7760L, NEB) and indexed with NEBNext® Multiplex Oligos for Illumina (catalog no ...
-
bioRxiv - Genomics 2023Quote: ... and strand-specific sequencing libraries were made using the NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs, E7760S) with eight cycles of amplification ...
-
bioRxiv - Microbiology 2023Quote: ... Pooled genomic DNA samples were used to sequence libraries constructed using the NEBNext Ultra II Library Prep Kit (NEB, Ipswich, USA). Paired-end metagenomics sequencing was performed on an Illumina NextSeq 550 sequencer using NextSeq High Output Kit v2 sequencing reagent kit ...
-
bioRxiv - Cell Biology 2023Quote: Libraries were prepared on an automated liquid handler (Biomek i7) using the NEBNext Ultra II DNA library preparation kit (NEB, E7645), according to the manufacturer’s instructions and without size selection ...
-
bioRxiv - Genomics 2023Quote: ... Paired-end libraries were constructed using NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (New England Biolabs, E7645S) using a starting material of 50 ng ...
-
bioRxiv - Microbiology 2023Quote: ... dual unique indexed libraries for sequencing on all Illumina platforms were made using the NEBNext Ultra™ II Directional RNA Library Prep Kit for Illumina (New England Biolabs). Manufacturer protocol was modified by diluting adapter 1:30 and using 3 μl of this dilution ...
-
bioRxiv - Microbiology 2023Quote: Libraries for RNAseq were prepared using the NEB Next Ultra II Directional RNA Library Prep Kit (New England Biolabs, Ipswich, MA). Individual libraries were uniquely barcoded with NEBNext Multiplex Oligos for Illumina sequencing platform (New England Biolabs ...
-
bioRxiv - Neuroscience 2022Quote: ... and P7-index-Read2-EGFP (CAAGCAGAAGACGGCATACGAGATAGGATTCGGTGACTGGAGTTCAGACGTGTGCTCTTC CGATCTGgCATGGACGAGCTGTACAAG) (200 nM each) were used as primers with the NEBNext Ultra II Q5 Master Mix (NEB, M0544L). Amplification was performed using the following PCR protocol ...
-
bioRxiv - Microbiology 2023Quote: ... The preparation of the sRNA-enriched library was done with NEBNext Ultra II RNA kit (New England Biolabs, Ipswich, MA, USA) following the manufacturer’s recommendation which included cDNA synthesis ...
-
bioRxiv - Neuroscience 2023Quote: ... Ribo-depleted RNA sequencing (RNA-seq) libraries were constructed using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, #E7765S). RNA samples were fragmented ...
-
bioRxiv - Developmental Biology 2023Quote: ... building parallel total-RNA and poly(A)+ Illumina strand-specific libraries using the Ultra II RNA-seq library kit (NEB #E7765) (see below) ...
-
bioRxiv - Systems Biology 2022Quote: ... A total of 500ng of purified RNA was used as input for the NEBNext Ultra II RNA Library Prep Kit (NEB #E7770S), which first involved enrichment of polyadenylated mRNA using the NEBNext Poly(A ...
-
bioRxiv - Immunology 2023Quote: ... Stranded RNA sequencing libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, cat# E7760L). Purified libraries were qualified on an Agilent Technologies 4150 TapeStation using a D1000 ScreenTape assay (Agilent ...
-
bioRxiv - Molecular Biology 2023Quote: ... Paired-end Illumina sequencing libraries were prepared from CUT&RUN enriched DNA using the NEBNext Ultra™ II DNA Library Prep Kit (New England Biolabs) and sequenced on a NextSeq 500 (Illumina) ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were harvested by phenol-chloroform extraction and processed according to the NEB Ultra II Directional RNA Sample Prep Kit (New England Biolabs, #E7760S).
-
bioRxiv - Genetics 2023Quote: ... strand-specific mRNA libraries were generated using the NEBNext Ultra II Directional RNA library prep Kit for Illumina (New England BioLabs #E7760), and mRNA was isolated using Poly(A ...
-
bioRxiv - Genetics 2023Quote: ... 100ng of each mRNA sample was used to prepare libraries with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB E7760S) according to the manual ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100ng of polyA selected mRNA samples were treated using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB E7760S) according to the manual ...
-
bioRxiv - Microbiology 2023Quote: ... A linker was ligated to the ends of DNA using the NEBNext Ultra II Ligation Module (New England Biolabs, Cat# E7595). The junction between the 3’LTR of HIV-1 and host genomic DNA was amplified using primers targeting the 3’LTR and linker regions.
-
bioRxiv - Genomics 2023Quote: ... Beads were washed with 200 μl buffer EB and resuspended in 400 μl of Post-TdT PCR mix (1x NEBNEXT Ultra II Q5 Master Mix (NEB, M0544L), 0.5 μM post-TdT-poly(C)12-S Primer ...
-
bioRxiv - Genomics 2023Quote: ... Hi-C library was purified by adding 80 μl Ampure beads and amplified in two 100 μl pre-amplification reactions (50 μl 2x NEBNEXT Ultra II Q5 Master Mix (NEB, M0544L), 5 μl 10 μM Nextera-P5-pre-Primer ...