Labshake search
Citations for New England Biolabs :
2801 - 2850 of 6440 citations for Type 1 Angiotensin II Receptor AGTR1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2021Quote: ... RNA-seq libraries were constructed with poly(A) mRNA enrichment and rRNA depletion processes using the NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs, Ipswich, MA). The indexed libraries were multiplex-sequenced in duplicate using two flow cells ...
-
bioRxiv - Microbiology 2021Quote: ... where RNA metagenomic libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA). Libraries were pair-end sequenced (2×150 bp ...
-
bioRxiv - Molecular Biology 2020Quote: ... Isolated mRNAs were reverse-transcribed into double stranded cDNA and subjected to sequencing library construction using the NEBNext Ultra™ II RNA Library Prep Kit for Illumina (NEB, E7770) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: Libraries were prepared with NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina according to the supplier recommendations (NEB). Briefly ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA sequencing libraries were prepared using the NEBNext Ultra II RNA Library Prep Kit for Illumina using manufacturer’s instructions (NEB, Ipswich, MA, USA). Briefly ...
-
bioRxiv - Genomics 2022Quote: ... NEBNext® UltraTM II Directional RNA Library Prep Kit for Illumina® and NEBNext® UltraTM II DNA Library Prep Kit for Illumina® according to the manufacturer’s instructions (New England Biolabs). Paired-end 100 bp reads were generated.
-
bioRxiv - Microbiology 2022Quote: Complementary DNA (cDNA) libraries were constructed with the Ultra II RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA, USA). cDNA concentrations were measured using a Qubit fluorometer with a dsDNA BR/HS kit (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA was transcribed to full-length cDNA using the SMART-Seq253 protocol and RNA-sequencing libraries were generated using the NEBNext® Ultra™ II FS DNA library preparation kit (New England Biolabs) according the manufacturer’s protocol with DNA input below 100 ng ...
-
bioRxiv - Genomics 2022Quote: ... and a PCR-free library was obtained with NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (New England Biolabs). Approximately 200 million of 150 bases pair-end reads were generated using the HiSeq X System (Illumina) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The library for RNA-Seq was prepared by using NEBNext Ultra II Directional RNA Library Prep kit (New England BioLabs, Ipswich, MA). During the second cDNA synthesis dUTP was incorporated to maintain strand specificity ...
-
bioRxiv - Cell Biology 2022Quote: ... The sample preparation was performed according to the protocol “NEBNext Ultra II Directional RNA Library Prep Kit for Illumina” (NEB #E7760S/L). Briefly ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA libraries were constructed using the NEBNext® Ultra(tm) II Directional RNA Library Prep Kit (New England Biolabs, Inc., Massachusetts, USA) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... The libraries of input fractions from Figure S8 were prepared using the NEBNext® Ultra™ II DNA Library Prep Kit for illumina (NEB).
-
bioRxiv - Molecular Biology 2020Quote: ... Libraries for sequencing were prepared using NEBnext Ultra II directional RNA library prep kit for Illumina (New England Biolabs, Cat. No E7760L). Libraries were sequenced on an Illumina HiSeq 1500 instrument at the Laboratory of Functional Genomic Analysis (LAFUGA ...
-
bioRxiv - Genomics 2021Quote: ... and NEBNext Ultra II FS DNA library kit for Illumina with 384-unique indexes (New England Biolabs, Massachusetts, USA; Cat. No: E6617L). Libraries were sequenced using the HiSeq X10 with 150 bp paired-end chemistry (Illumina ...
-
bioRxiv - Molecular Biology 2020Quote: ... The RNAs were reverse transcribed to cDNA using ProtoScript II reverse transcriptase with oligo dT and random primers (First Strand cDNA Synthesis kit New England Biolabs, Ipswich, MA). RT-PCRs specific for the Cas9 or actin gene of B ...
-
bioRxiv - Microbiology 2020Quote: ... we prepared a fragmented DNA library using a NEBNext Ultra II FS DNA Library Prep Kit for Illumina according to the manufacturer’s instructions (New England Biolabs, Ipswich, MA, USA). Sequencing of a paired-end 2 × 150 bp mode on a HiSeq X system (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... were prepared using NEBNext® Ultra™ II FS DNA Library Prep Kit for Illumina modules E7810L and E7595L (New England BioLabs) following the manufacturer protocol for use with inputs ≥ 100 ng with modifications to eliminate PCR-amplification steps.
-
bioRxiv - Immunology 2021Quote: ... The RNA sequencing libraries were prepared using the NEBNext Ultra II RNA Library Prep Kit for Illumina using manufacturer’s instructions (New England Biolabs, Ipswich, MA, USA). Briefly ...
-
bioRxiv - Microbiology 2021Quote: The DNA library was prepared using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s instructions and sequenced using the Illumina MiSeq platform with a read length of 2 × 150 bp (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... we performed second strand synthesis using the NEBNext Ultra II Non-Directional RNA second strand synthesis module as per the suggested protocol (NEB, Catalog# E6111L). The synthesized DNA was purified via 1X Mag-Bind TotalPure NGS beads and eluted in ~12 ul of sterile water ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA sequencing libraries were prepared from 100 ng of input RNA using the non-directional kit NEBNext Ultra™ II RNA Library Prep Kit for Illumina (NEB, #E7775) with the NEBNext Poly(A ...
-
bioRxiv - Microbiology 2022Quote: ... The cDNA preparation was performed following the instructions of the manufacturer of the ProtoScript II Reverse Transcriptase (New England Biolabs, Massachusetts, USA). Random primers (ThermoFisher ...
-
bioRxiv - Microbiology 2022Quote: ... The rRNA-depleted total RNA was subjected to library preparation using NEBNext® Ultra™ II RNA Library Prep Kit (E7700, NEB) and barcoded with NEBNext Multiplex Oligos for Illumina (E7730 ...
-
bioRxiv - Systems Biology 2022Quote: ... total RNA libraries were built using the NEBNext Ultra II library prep kit for Illumina (New England BioLabs inc., product code: E7775) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... A total of 1 μg of genomic DNA was repaired and 3’-adenylated with the NEBNext FFPE DNA Repair Mix and the NEBNext® Ultra™ II End Repair/dA-Tailing Module and sequencing adapters ligated using the NEBNext Quick Ligation Module (NEB). After library purification with AMPure XP beads ...
-
bioRxiv - Microbiology 2019Quote: ... coli DNA and 2 μg of Salmonella DNA in a total of 100 μL each were added to the NEBNext® Ultra™ II End Repair/dA-Tailing module (New England Biolabs (NEB), USA ...
-
bioRxiv - Molecular Biology 2019Quote: ... The single guide RNA with sequence GATATCAGTCTGTTTCGTAA targeting chromosome II near the ttTi5605 Mos1 insertion site was cloned into pJW1219 using Q5 Site-Directed Mutagenesis (NEB, Ipswich, MA). Worms containing unintegrated transgenic DNA arrays were eliminated by screening for the absence of plasmids pCFJ90 (Pmyo-2::mCherry ...
-
bioRxiv - Microbiology 2020Quote: ... as previously described[7] Phage DNA libraries were prepared using NEBNext Ultra II FS library Prep and Kit for Illumina (New England Biolabs, Ipswich, USA). The sequencing was performed on the Illumina iSeq platform as part of a flowcell (2 x 151 ...
-
bioRxiv - Genomics 2019Quote: ... cDNA was generated using random hexamer priming and the Protoscript II First Strand cDNA Synthesis Kit (New England Biolabs, Ipswich, MA, USA). We amplified cDNA using the ZikaAsian V1 ZIKV-specific primer scheme [20] ...
-
bioRxiv - Genomics 2019Quote: ... Library preparation for sequencing was performed using a NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (E7645, New England Biolabs NEB). Samples were sequenced paired-end ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and cDNA libraries were made from each sample using the NEBNext RNA Ultra II Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA). Barcoded samples were sequenced using the Illumina NextSeq 500 (Illumina ...
-
bioRxiv - Genomics 2019Quote: ... the DNA was then converted into double indexed Illumina libraries using the NEBNext® Ultra™ II DNA Library Prep kit (New England Biolabs® ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNA libraries for Illumina sequencing were constructed using the NEBNext Ultra II RNA Library Prep Kit for Illumina (New England BioLabs, MA, USA) following the manufacturer’s protocol in 0.5 of the recommended volume (due to low RNA quantity in such samples as shoot apical meristem) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sample preparation was performed according to the protocol “NEBNext Ultra II Directional RNA Library Prep Kit for Illumina” (NEB #E7760S/L). Briefly ...
-
bioRxiv - Molecular Biology 2020Quote: ... The sample preparation was performed according to the protocol “NEBNext Ultra II Directional RNA Library Prep Kit for Illumina” (NEB #E7760S/L). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... The beads were then re-suspended in 23 μL of 10 mM Tris-Cl pH 8.0 and libraries were prepared by on-bead reactions using NEBNext® Ultra™ II DNA Library Preparation Kit (NEB, E7645S). The beads were separated on a magnetic stand and the supernatant was discarded ...
-
bioRxiv - Neuroscience 2021Quote: ... The libraries were prepared from total RNA enriched for mRNA using the NEBNext Poly(A) mRNA Magnetic Isolation Module and the NEBNext Ultra II Directional RNA Library Preparation Kit for Illumina (New England Biolabs, MA, USA) and sequenced on an Illumina NextSeq 500 instrument (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... NEBNext® UltraTM II Directional RNA Library Prep Kit for Illumina® and NEBNext® UltraTM II DNA Library Prep Kit for Illumina® according to the manufacturer’s instructions (New England Biolabs).
-
bioRxiv - Cancer Biology 2021Quote: ... 3 to 15 ng of immunoprecipitated DNA were used to prepare the sequencing libraries using the NEBNext Ultra II DNA Library Prep Kit (NEB, Ref: E7645S) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Purified RNA was submitted to the University of Virginia Genome Analysis and Technology Core for whole transcriptome sequencing by first library preparation with NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB Cat #E7760) and then sequencing by Illumina NextSeq 500 Sequencing System for paired-end 75bp reads ...
-
bioRxiv - Genetics 2021Quote: ... DNA libraries were prepared using 300 ng of fragmented DNA following the instructions of the NEBNext® Ultra™ II DNA Library Prep kit (New England Biolabs). Samples were sequenced on a HiSeq 2500 (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... and once the solution is clear 48 uL of the elution was transferred to a 2mL Lo-Bind tube with End-Repair and A-tail buffer (7 uL) and enzymes (3 uL) premixed (NEBNext® Ultra™ II kit, New England Biolabs). The solution was then mixed by gentle tapping and transferred to a 0.2 mL PCR tube and incubated at 20 degrees C for 30 minutes and 65 degrees C for 30 minutes in a thermocycler ...
-
bioRxiv - Genomics 2019Quote: ... The available CPQ cDNA was previously prepared from total RNA derived from midguts of fifth-instar larvae fed on semi-synthetic diet using a Protoscript II kit (NEB, Ipswich, MA). PCR was carried out on both strains using primers designed to flank the region of the kdr mutation in the para gene (Forward 5’-ACCAAGGTGGAACTTCACAGAT −3’ Reverse 5’-AGCAATTTCAAGAAGTCAGCAACA −3’) ...
-
bioRxiv - Microbiology 2021Quote: ... RNA-Seq libraries were prepared from these enriched samples and from unenriched control “gold standard” samples (i.e. “Unenriched”) using the NEBNext® Ultra™ II Directional RNA Library Prep with Sample Purification Beads (NEB #E7765) and NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... were treated by an end-repair/dA tailing using NEBNext® Ultra™ II End Repair/dA-Tailing Module (New England Biolabs) and NEB Blunt/TA Ligase Master Mix (New England Biolabs) ...
-
bioRxiv - Immunology 2020Quote: ... Two hundred nanograms of total RNA was subsequently processed to generate RNA-seq libraries using NEBNext Poly(A) mRNA Magnetic Isolation and Ultra II Directional RNA Library Prep kit for Illumina (NEB E7490, E7760) according to manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... and end-repair processing using the NEBNext Ultra II RNA Library Prep with Sample Purification Beads (New England Biolabs, catalog no. E7775L). Adapters and unique dual indexes in the NEBNext Multiplex Oligos for Illumina (New England Biolabs ...
-
bioRxiv - Genomics 2021Quote: ... The Hi-C library for Illumina sequencing was prepped using the NEBNext® Ultra™ II DNA library Prep Kit for Illumina (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... We prepared genomic DNA libraries for each sample using the NEBNext® Ultra II DNA Library Prep Kit for Illumina® (New England Biolabs), following manufacturer’s instructions ...