Labshake search
Citations for New England Biolabs :
201 - 250 of 347 citations for pVectOZ GFP Transfection control since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... actin57B and actin57B PT-Mutant CDSs were individually cloned upstream of GFP by digesting with SpeI (NEB, R0133S). Constructs were ligated through Gibson Assembly (NEB ...
-
bioRxiv - Developmental Biology 2021Quote: ... This fragment was inserted in front of a codon optimized GFP via the HiFi DNA Assembly kit (NEB) with the addition of a membrane-tethering CAAX domain at the C-terminus to visualize the morphology of the cells expressing the reporter protein ...
-
bioRxiv - Biochemistry 2022Quote: CSF3R constructs were cloned into an MSCV-IRES-GFP (MIG) plasmid digested with XhoI (New England Biolabs R0146S). For the constructs with truncated domains ...
-
bioRxiv - Bioengineering 2022Quote: ... ligated circular DNAs were amplified using GFP reporter-specific primers (IDT) and Q5 hot start DNA polymerase (NEB). Amplified DNA was sequenced (Azenta ...
-
bioRxiv - Biochemistry 2020Quote: ... PfCPT-HA-TetR-DOZI and PfCPT-TetR-DOZI products were linearized for transfection using HPaI (New England BioLabs, Ipswich, MA, USA). Primers forward P15 and reverse 16 were used for annealing and insertion of the guide RNA into pUF1 vector previously digested.
-
bioRxiv - Bioengineering 2019Quote: ... All BACs except DHFR BAC derived BACs were linearized before transfection: 2207K13-UG BAC with SgrAI (New England Biolabs, Cat. # R0603S), HBB-UG BAC with NotI (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... and day 14 post-transfection and genomic DNA (gDNA) was extracted using Monarch Genomic DNA Purification Kit (New England Biolabs, T3010L). Target regions were amplified by PCR to add barcodes for multiplexing ...
-
bioRxiv - Developmental Biology 2021Quote: ... Library preparation (from precipitated material and input chromatin as control) was performed using NEBNext Ultra II DNA library Prep Kit (New England Biolabs, #E7645S) without size-selection to maintain sample complexity and according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... The guide RNA or scrambled control sequences (Supplementary Table S1) were subcloned into the lentiCRISPR v2 using the BsmBI restriction endonuclease (NEB R0580S). Virus was produced through PEI (MilliporeSigma ...
-
bioRxiv - Molecular Biology 2020Quote: ... Spike-in RNA of the bacteriophage MS2 served as an interal control and was detected with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs) using corresponding primers and probe (MS2_F ...
-
bioRxiv - Biochemistry 2021Quote: ... were synthesized in the TCRB/TCRA orientation (Integrated DNA Technologies) and cloned into a lentiviral vector under the control of the pEF1α promoter using Gibson assembly (New England Biolabs Inc). For generation of TCRs ...
-
bioRxiv - Genomics 2021Quote: ... 2 μg genomic DNA from mESCs (both, with DSB induction and control without the induction) were digested using 1 μl 100 U/μL XbaI (NEB, #R0145T) and 4 μl 5 U/μL I-SceI (NEB ...
-
bioRxiv - Neuroscience 2021Quote: The expression clone for both the peptide of interest and the control was transformed into competent DH5α cells (NEB® [New England Biolabs] 5-alpha Competent E ...
-
bioRxiv - Cell Biology 2019Quote: ... The decoupling and control construct were assembled via Gibson cloning using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs). The decoupling construct contained the C-terminal end of the nesprin-3 gene (Syne3 ...
-
bioRxiv - Molecular Biology 2021Quote: ... mCherry and control (GAPDH) expression levels were measured separately by qPCR from 4 uL of diluted cDNA using Taq DNA Polymerase (NEB, #M0270L), dsGreen DNA detection dye (Lumiprobe ...
-
bioRxiv - Microbiology 2022Quote: ... Around 100ng of the RNA was kept as input control and stored at -80°C whereas the remaining amount was subjected to immunoprecipitation using m6A specific antibody (NEB #E1610S). Initially ...
-
bioRxiv - Cancer Biology 2023Quote: ... NGS sequencing libraries were prepared from 1 µg of genomic DNA spiked with known ‘spike-in’ controls by introducing Illumina adaptors and 5-bp-long index sequences using Q5® High-Fidelity 2X Master Mix (NEB). The barcode amplification was verified in parallel polymerase chain reaction (PCR ...
-
bioRxiv - Genomics 2023Quote: ... Included in the gel as controls were an RT reaction conducted in the absence of tRNA and a Small Range RNA Ladder (NEB N0364S). The gel was stained with SYBR gold and visualized using a ChemiDoc imager (BioRad) ...
-
bioRxiv - Genomics 2023Quote: ... 1 µg of genomic DNA was pooled with 1:20 dilutions of unmethylated lambda (1 µl of 0.1 ng/µl) and methylated pUC19 control DNA (1 ul of 0.005 ng/µl) from the EM-seq kit (E7120L; NEB, Ipswich, MA). Volumes were made up to 50 ul with 0.1x TE buffer (Sigma-Aldrich ...
-
bioRxiv - Genetics 2024Quote: Wild-type minigene plasmids were prepared using target exons and variable flanking intronic sequences of the DMD gene amplified from a control genomic DNA using Q5 High-Fidelity DNA Polymerase (NEB, USA). The primers that were used are described in Table S1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and then cloned into the lentiviral expression vectors coexpressing a puromycin resistance gene or GFP (pLX_TRC307 and pLX_TRC312 from GPP) using a Gibson Assembly Cloning Kit (New England Biolabs E5510S). dTAG expression vector and dTAGV-1 compound were kindly provided by Dr ...
-
bioRxiv - Biochemistry 2020Quote: ... and then the product was cloned into the pCINeo-IRES-GFP vector using NheI and XhoI (New England Biolabs). To obtain truncated CNNM2 plasmids ...
-
bioRxiv - Plant Biology 2021Quote: The 6K1:GFP constructs and its derivatives were produced using the Gibson cloning kit (New England Biolabs, Ipswich, MA) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 107 epimastigotes were electroporated with 2.5 µg of pTRIX2-GFP plasmid (Fig 1 A) linearized with AscI and SacI (NEB). The plasmid had been derived from pTRIX-REh9 [28] ...
-
bioRxiv - Microbiology 2020Quote: ... Infection was done with HIV-1NL-GFP passed through 0.2 μM filters (MilliporeSigma Durapore) and treated with 20 U/mL DNaseI (New England Biolabs) for 60 minutes at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... Briefly 5 µg pAc CrPV 5’UTR-1A-GFP-3’ or pCrPV-3 plasmids were linearized with Eco53KI (NEB) or 5 µg pTOPO dsRNA plasmids with EcoR1 (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: pTol2 HS:cachd1,GFP: Full-length cachd1 was amplified from cDNA using high-fidelity Phusion DNA polymerase (New England Biolabs) and then phosphorylated with PNK (New England BioLabs ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The resulting PCR fragments were re-assembled into pY2H-GFP digested with BssHII and NdeI using Gibson cloning (NEB) and confirmed by sequencing ...
-
bioRxiv - Cell Biology 2019Quote: ... The GFP-Rab5C PCR product and a pLXIN-I-NeoR plasmid were digested using Hpa1 (New England Biolabs – R0105) and Not1 (New England Biolabs – R3189 ...
-
bioRxiv - Microbiology 2022Quote: ... The first fragment was generated by amplifying the GFP from pcDNA3.1-GFP (a gift from Carolyn Coyne, Duke University) using Q5 high-fidelity DNA polymerase (New England Biolabs) with NheI-GFP_F (5’-GAAGCTAGCCACCATGGTGAGCAAGGGCGAGGAG-3’ ...
-
bioRxiv - Physiology 2022Quote: ... The scAAV-CMV-GFP plasmid was digested with EcoRI and HpaI (New England Biolabs; Cat. Nos. R3101 and R0105) and the linearized scAAV-CMV plasmid without the GFP was gel purified ...
-
bioRxiv - Molecular Biology 2022Quote: The sf-GFP reporter protein was expressed essentially as described 38 in the PURExpress ΔRF123 system (New England Biolabs). The DNA template was PCR-amplified from the pY71sfGFP plasmid 58 by PCR using primers sfGFP-fwd and sfGFP-rev (all primers are listed in Supplementary Table S2) ...
-
bioRxiv - Immunology 2023Quote: pals-17::gfp and pals-20::wrmScarlet translational reporter constructs were assembled using NEBuilder HiFi kit (New England Biolabs) by fusing PCR products and gene fragments ...
-
bioRxiv - Genetics 2023Quote: ... digested pJFRC12-10XUAS-IVS-myr::GFP backbone using the following reactions conditions: 4 µL T4 ligase buffer (10x) (NEB), 20 µl plasmid backbone DNA (0.005 pmol) ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by the GFP sequence were generated by using the HiScribe T7 ARCA mRNA Kit (New England Biolabs, E2060). 1 µg mRNA was first denatured at 65°C for 3 minutes ...
-
bioRxiv - Immunology 2021Quote: ... It was then linearized for transfection by digesting 150 μg of DNA with 3,000 units PvuI-HF restriction enzyme (New England Biolabs, Ipswich, MA, USA), precipitated ...
-
bioRxiv - Genomics 2019Quote: ... and then cloned into a customized minigene plasmid (a derivative of the pSpliceExpress vector)29 containing an RSV-promoter and two control exons (rat insulin exons 2 and 3) using the NEBuilder® HiFi DNA assembly (NEB, E2621). Amplified fragments were inserted between the two control exons ...
-
bioRxiv - Biochemistry 2020Quote: ... or a control motif (5’-GGGACCCTGGGAGGG-3’) were prepared by viral replication using a helper phage M13K07 (New England BioLabs, Cat#N0315S). E.coli XL1-Blue cells were transformed with pBluescript SK(- ...
-
bioRxiv - Microbiology 2021Quote: ... CRISPR constructs were generated by cloning an ACE2-targeting gRNA sequence [TACCAAGCAAATGAGCAGGG] or a nontargeting control gRNA sequence [CGTGTGTGGGTAAACGGAAA] into Esp3I (New England Biolabs, Ipswich MA) sites of the pLentiCRISPRv2 backbone (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: DNA encoding XFP1-10 protein was transformed and expressed under the control of an arabinose inducible promoter in Escherichia coli strain BL21(DE3) (New England BioLabs, Ipswich, MA). Cells were grown in Luria broth medium to an initial optical density of 0.2 ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA of TET21-N cells (Control and 24 h doxycycline) was extracted using the Monarch Total RNA Miniprep Kit (New England Biolabs, Hitchin, UK), from which complementary DNA (cDNA ...
-
bioRxiv - Bioengineering 2024Quote: Linear dsDNA templates were made via PCR amplification was done using the GD2-CAR or no CAR Control plasmid as a template using Q5 Hot Start Polymerase (Cat # M0494S, NEB, Ipswich, MA) in 50 uL reaction volumes ...
-
bioRxiv - Cell Biology 2020Quote: ... the cDNA of RDGB corresponding to amino acids 947-1259 was subcloned in pJFRC::GFP vector using the restriction enzymes BglII and NotI (NEB). A flexible linker of Gly(G)-Ser(S ...
-
Bidirectional neuronal migration coordinates retinal morphogenesis by preventing spatial competitionbioRxiv - Developmental Biology 2021Quote: ... The pCS2+ vector containing GFP tagged calponin homology domain of human utrophin (GFP-UtrophinCH) 48 was used as template for generation of pME GFP- UtrophinCH by PCR using Phusion polymerase (New England Biolabs) and primers with ATT recombination site (shown in lower case) ...
-
bioRxiv - Biochemistry 2022Quote: Reporter protein-expressing plasmids for measuring Tyr decoding ability were generated by integrating frameshift sequences testing Tyr codon decoding and linearized from pMMB207 encoding mCherry and bright GFP using NEBuilder HiFi DNA Assembly Master Mix (NEB).
-
bioRxiv - Cell Biology 2022Quote: SDS-PAGE and Western blot analysis were performed as previously described (Alpy et al, 2005) using the following antibodies: rabbit anti-GFP (1:2000; TP401, Torrey Pine Biolabs), rabbit anti-MOSPD2 (1:250 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and the pSpCas9(BB)-2A-mCherry (generated in house, by replacing the GFP with a mCherry reporter using the NEBuilding HiFi DNA Assembly Cloning Kit [New England Biolabs]). All sgRNAs sequences can be found in table S1.
-
bioRxiv - Biochemistry 2019Quote: ... and cloned into a modified pOEM vector as HRV 3C-cleavable N-terminal GST fusion construct (GST-C1-GFP-NES) using the restriction enzymes NotI and AscI (NEB).
-
bioRxiv - Molecular Biology 2019Quote: ... that were integrated into various backbone plasmids (e.g. p28-GFP, p28-HA, or TCV_sg2R) using Gibson Assembly cloning (NEB, Ipswich, MA). The identities of all new constructs were verified with Sanger sequencing.
-
bioRxiv - Bioengineering 2019Quote: ... the GFP cassette between KpnI/HpaI restriction sites of plasmid GFP-Fibrillarin was replaced with a 730 bp Cerulean cassette PCR amplified from plasmid pCerulean-N1 (New England Biolabs) using primer pair ForCerFib/RevCerFib ...