Labshake search
Citations for New England Biolabs :
151 - 200 of 347 citations for pVectOZ GFP Transfection control since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... GFP and taCA were cloned by polymerase chain reaction (PCR) using pMAL-c5X (New England Biolabs, USA), pGEX-4T-1 (GE Healthcare ...
-
bioRxiv - Systems Biology 2022Quote: ... JunDN-HA-T2A-GFP was amplified from the pLVX-CMV backbone using Phusion Mastermix (NEB, catalog # M0531), and inserted into the empty backbone of pAK_Tol2_TRE_Puro (Addgene ...
-
bioRxiv - Synthetic Biology 2020Quote: ... formerly constructed PdnaK-IR3-IR3 GFP pZa vector60 was digested with MluI restriction endonuclease enzyme (R3198, NEB) to exclude gfp from the vector ...
-
bioRxiv - Genetics 2019Quote: ... 2012) by removing cbr-Pmyo-2∷gfp∷his-72 UTR by cutting using KpnI and ApaI (NEB). The digested pZZ0031 backbone carrying cbr-unc-119(+ ...
-
bioRxiv - Synthetic Biology 2021Quote: The CFP and GFP reporter plasmids were propagated in either dam-/dcm-strain C2925 (New England Biolabs) or dam+/dcm+ strain DH5-alpha Turbo (NEB C2984 ...
-
bioRxiv - Cell Biology 2021Quote: ... mexicana genomic DNA and cloned into the pNUS C-Ter GFP NEO (pGL1132) using HiFi Assembly (NEB) to generate a complementation vector ...
-
bioRxiv - Cell Biology 2022Quote: ... where the GFP-LGN sequence was removed by restriction digestion with Bsu36i and PspOMI (New England Biolabs). The primers were 5’-CCGACCTGAGGAAGGGAG3-3’ (forward ...
-
bioRxiv - Molecular Biology 2023Quote: ... The LT3-GFP-T7-PGK-Neomycin vector was digested with XhoI and EcoRI-HF (New England Biolabs). An shRNA targeting the Renilla luciferase (Ren713 ...
-
bioRxiv - Molecular Biology 2023Quote: ... the GFP RNA was linked to the treated linker with T4 RNA ligase 1 (New England Biolabs). The obtained RNA was purified with the Monarch RNA purification kit (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... E117G and G118V were generated from GFP-PFN1 plasmid using site-directed mutagenesis (Q5 New England Biolabs) with the following primers ...
-
bioRxiv - Neuroscience 2020Quote: ... pSico Nectin-3-shRNA and scramble-shRNA constructs were altered before transfection to artificially replicate Cre-excision using site-directed mutagenesis (Q5 site directed mutagenesis kit: New England Biolabs). The GFP-stop sequence and one loxP site were removed from pSico using the following primers ...
-
bioRxiv - Molecular Biology 2019Quote: ... As a positive control, a concentration range (0.25, 1, 4, 16 units) of Dam enzyme was used (New England BioLabs #M0222S). Next ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gluc200 and Gluc200A44 templates were generated using PCR amplification of GLuc of the first 200 nt at the 5’end of pCMV-GLuc 2 Control Plasmid (NEB: https://www.neb.com/tools-and-resources/interactive-tools/dna-sequences-and-maps-tool) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The relaxed plasmid in control samples was generated by treatment of the supercoiled plasmid with RNase H2 (New England Biolabs) for 2 hours at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... 180 ng control linearized plasmid DNA and 180 ng of 3C library was treated with either 0.5 Unit exonuclease V (NEB, M0345) or 0.5 Unit T5 exonuclease (NEB ...
-
bioRxiv - Genomics 2020Quote: ... Irradiated and control DNA was either loaded directly on a 1% agarose gel or incubated with T4 endonuclease V (New England Biolabs) for 30 minutes at 37°C and subsequently analyzed by agarose gel electrophoresis using a 1% agarose gel.
-
bioRxiv - Molecular Biology 2020Quote: ... Plasmid #1129 used to obtain transgenic fish line expressing LifeAct-frFAST fusion under the control of the cmlc2 enhancer28 was constructed using the NEBuilder assembly kit (New England BioLabs) in the pT22i vector for transgenesis previously used29.
-
bioRxiv - Microbiology 2019Quote: Site-directed mutagenesis of low copy number vector p3187 harbouring siiA::HA under control of PsiiA was performed by using the Q5 SDM kit according to the manufacturer instructions (NEB) (Table S9) ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: Frameshifting reporter as well as positive and negative control mRNAs were in vitro transcribed and polyadenylated using HiScribe T7 mRNA kit (New England Biolabs) according to the manufacturers’ instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... miR158 OE and pseudo-PPR OE (one of these libraries failed the quality control).Libraries were prepared using NEB Next Small RNA Library Prep Set (New England Biolabs) and sequencing was carried out using Illumina HiSeq 4000 in single-end mode by outsourcing ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products containing the alanine mutation were cloned under the control of the ara promoter by insertion into pBAD33 by digestion with Kpn1 (NEB) and Sph1 (NEB) ...
-
bioRxiv - Genomics 2021Quote: ... The reactions were combined and 2.5 μL of the assembly reaction or a control reaction without amplicon were used to transform NEB5-alpha cells (New England Biolabs) to measure background assembly ...
-
bioRxiv - Genomics 2022Quote: ... The libraries were prepared from 200ng of input DNA with control DNA (CpG methylated pUC19 and CpG unmethylated lambda DNA) using NEBNext Enzymatic Methylation-seq kit (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: Enhancer and control regions (500-600 bp) were amplified from human genomic DNA from HEK293T cells using Q5 High-Fidelity Polymerase (NEB). Amplified fragments were cloned into pGL4.23 plasmid (Promega) ...
-
bioRxiv - Neuroscience 2019Quote: ... 1µg of total RNA underwent quality control (Bioanalyzer) and was prepared for directional RNA sequencing using NEBNext reagents (New England Biolabs) or SureSelect Strand Specific RNA Library Prep Kit (Agilent Technologies ...
-
bioRxiv - Systems Biology 2019Quote: ... the sRNA gene of interest was cloned at the transcriptional +1 site under Para control by amplifying the pBAD+1 plasmid (Supplementary Table 5) by inverse PCR using Q5 DNA Polymerase (NEB). The pBAD+1 template is derived from pBADmycHisA (Tree et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... 6His(TEV)nsp8 and nsp7L8(TEV)6His were expressed under the control of a T5-promoter in pQE30 vectors in Escherichia coli (E. coli) NEB Express C2523 cells (New England Biolabs) carrying the pRARE2LacI (Novagen ...
-
bioRxiv - Genetics 2020Quote: ... PIK3C2B intron 10 fragment was amplified from the control hPSC genomic DNA and NFIA ORF was amplified from the control hNP cDNA using Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs). PIK3C2B intron 10 fragment was cloned into NanoLuc luciferase reporter construct (pNL3.2[NlucP/minP] ...
-
bioRxiv - Genomics 2020Quote: ... we prepared libraries of circle-enriched and whole genomic control samples using NEBNext FS DNA Ultra II Library Prep Kit (New England Biolabs) using protocol modifications outlined in (Sproul and Maddison 2017) ...
-
bioRxiv - Bioengineering 2022Quote: ... DNA templates are prepared by inserting protein-coding sequence of gLuc (pCMV-GLuc control vector, New England BioLabs, Ipswich, MA) into pSP73 vectors (Promega ...
-
bioRxiv - Immunology 2023Quote: Genomic DNA corresponding to selected and diversity control samples were PCR amplified with NEBNext High-Fidelity 2X PCR Master Mix (New England Biolabs) as described in20 ...
-
bioRxiv - Microbiology 2023Quote: ... On-bead RNase H treatment control was performed for each reaction: washed beads were incubated with 300 µL 1X RNase H Buffer (NEB) plus 30 units of RNase H (NEB ...
-
bioRxiv - Plant Biology 2023Quote: ... The MBP-OsTLP protein or the MBP control protein was bound to amylose resin (New England Biolabs, Beverley, MA, USA), and then the LssaCA-His protein was added to the beads ...
-
bioRxiv - Genetics 2023Quote: ... The expression and activity of the single-vector CROPseq plasmid was tested by cloning in a sgRNA targeting the DNMT3B (sgRNA sequence: CAGGATTGGGGGCGAGTCGG) or LacZ control gene (sgRNA sequence: TGCGAATACGCCCACGCGAT) using Gibson Assembly method and transformed into NEBStable bacteria (NEB) as outlined by Datlinger and colleagues19 and tested in HEK293A cells (Life Technologies) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and cloned under control of the hlh-3 promoter in pSL780 (Bone et al., 2016) with Gibson cloning (New England Biolabs) to generate pSL814 ...
-
bioRxiv - Microbiology 2023Quote: ... The mWasabi sequence under the control of the constitutive Pleft* promoter45 was amplified by PCR using a Q5 high-fidelity DNA polymerase (New England Biolabs). Plasmids were linearized with KpnI-HF (New England Biolabs) ...
-
bioRxiv - Neuroscience 2023Quote: Control and DRP1 gRNA were cloned into a plasmid containing a U6 promoter using BstXI and BlpI restriction enzymes (NEB) (gifted by Dr ...
-
bioRxiv - Microbiology 2023Quote: ... Secreted cypridina Luciferase (cLuc) activity from the internal control plasmid was similarly measured using the cypridina Luciferase kit (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... 8 injected embryos and 8 control uninjected siblings were assayed by PCR amplification and T7 endonuclease (New England Biolabs, M0302S) digest for mutation analysis41 ...
-
bioRxiv - Bioengineering 2024Quote: ... And cloned into a expression plasmid under the control of the EF1α using NEB High-Fidelity DNA Assembly 2x Master Mix (New England Biolabs). To generate 3’ and 5’ stop codon reporters ...
-
bioRxiv - Microbiology 2020Quote: ... The ClbI C-terminal GFP fusion was constructed using the Gibson Assembly kit (New England Biolabs, MA, USA). Briefly ...
-
bioRxiv - Biochemistry 2021Quote: ... and C250 (derived from pX461, GFP replaced with dsRED (Lindner et al. 2017)) were digested with BbsI (NEB) and ligated with the following annealed oligomers:
-
bioRxiv - Molecular Biology 2019Quote: ... and a DNA fragment containing GFP were inserted into pCAGEN by NEBuilder HiFi DNA Assembly Master Mix (NEB).
-
bioRxiv - Cell Biology 2019Quote: ... and assembled into pFA6a-GFP-hisMX6 (Longtine et al. 1998) digested with SalI and PacI (New England BioLabs).
-
A Bidirectional Switch in the Shank3 Phosphorylation State Biases Synapses toward Up or Down ScalingbioRxiv - Neuroscience 2021Quote: ... Constructs expressing GFP-tagged or HA-tagged Shank3 phospho-mutants were generated using the Gibson Assembly kit (NEB) with the wild-type Shank3 as the template ...
-
bioRxiv - Cell Biology 2021Quote: ... The mutant library was introduced into the pREP1-Pnmt1-GFP vector backbone by Gibson assembly (New England Biolabs). In this vector ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA linearization of Aurka-Gfp and H2b-mCherry constructs was carried out using Nde I (New England BioLabs), whereas DNA linearization of eGfp-Eb3 construct was carried out using SfiI (New England BioLabs) ...
-
bioRxiv - Evolutionary Biology 2022Quote: The DMRT regulatory region was amplified from the DMRT>GFP plasmid [28] using Phusion polymerase (New England Biolabs) with primers ...
-
bioRxiv - Cell Biology 2021Quote: ... and cloned into a pCMV-GFP vector (gift from Jens Lüders) by restriction digest and HiFi assembly (NEB).
-
bioRxiv - Developmental Biology 2020Quote: UASp-KibS677A-GFP-FLAG was generated using Q5® Site-Directed Mutagenesis Kit (New England Biolabs, Catalog #E0554S) using primers KibS677A (see primers table) ...