Labshake search
Citations for New England Biolabs :
51 - 100 of 347 citations for pVectOZ GFP Transfection control since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... of the SARS-CoV-2 Positive Control (N gene) plasmid (NEB N2117). Sanger sequencing confirmed successful mutagenesis ...
-
bioRxiv - Developmental Biology 2020Quote: ... plasmid pIG1783-Smkin3-gfp was used for Q5 mutagenesis (NEB biolabs). With specific primers (Table S3) ...
-
bioRxiv - Cell Biology 2019Quote: ... into pRS406-ADH1-GFP linearized with XbaI/BamHI (New England Biolabs).
-
bioRxiv - Developmental Biology 2020Quote: ... pLenti CMV-GFP-Puro was digested with BamHI and SalI (NEB) to remove GFP cassette and served as the vector backbone ...
-
bioRxiv - Cell Biology 2021Quote: ... EJ5-GFP insertion was verified by PCR (OneTaq, New England Biolabs). CHO-K1 ATM+ was generated by transfecting a clonal population of CHO-K1 EJ5-GFP with a Cas9:tracrRNA:sgRNA ribonucleoprotein particle (Integrated DNA Technologies) ...
-
bioRxiv - Plant Biology 2022Quote: ... and MBP-HIS-GFP proteins were purified with amylose resin (NEB) and SUMO-HIS-BIN2 protein was purified with Ni-NTA Agarose (Qiagen).
-
bioRxiv - Biophysics 2023Quote: ... The LRRC8A-GFP-PhoCl-TMEM plasmid was digested with AgeI (NEB) and EcoRI (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 μg BSA per well dealt as negative control (NEB, Ipswich, MA, USA). Samples were applied in a final volume of 100 μl coating buffer (100 mM Tris-HCL pH 8 ...
-
bioRxiv - Cancer Biology 2022Quote: ... DHFR control plasmid from PURExpress In Vitro Protein Synthesis Kit (New England Biolabs) was used as backbone for subsequent ligations ...
-
bioRxiv - Cell Biology 2023Quote: ... and pSNAPf-H2B control plasmid (Addgene #101124, New England Biolabs and Ana Egana) using KpnI and NotI ...
-
bioRxiv - Molecular Biology 2022Quote: ... the FLuc Control Template from the HiScribe T7 high yield RNA synthesis kit (NEB) was in vitro transcribed and purified as described the linearized pTXB1 vector.
-
bioRxiv - Immunology 2022Quote: ... As an isotype control an unspecific polyclonal rabbit antibody was used (NEB, Frankfurt, Germany). To block ORF8 during differentiation it was preincubated with the polyclonal rabbit anti-ORF8 antibody or isotype over night and added to the monocytes (t=0 ...
-
bioRxiv - Biochemistry 2021Quote: ... Control samples containing only RNA were treated with RNA 5’ Pyrophosphohydrolase (RppH, NEB, M0356S) to convert 5’-PPP RNA into 5’-P RNA ...
-
bioRxiv - Microbiology 2021Quote: ... and GFP-bGSDM fusion constructs were cloned using the Gibson assembly (NEB). The Runella bGSDM was amplified from genomic DNA that was ordered from the DSMZ (DSM 19591 ...
-
bioRxiv - Biochemistry 2020Quote: ... but no GFP) linearized with the ApaLI restriction enzyme (New England Biolabs) and (ii ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP or mCherry2 with Bgl2 sites was generated by Phusion PCR (NEB) with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg ...
-
bioRxiv - Genetics 2020Quote: ... digested CSCW-Gluc-IRES-GFP using Gibson Assembly (E2611S, New England BioLabs). pCVL SFFV d14GFP EF1s HA.NLS.Sce(opt ...
-
bioRxiv - Plant Biology 2020Quote: ... Purified MBP-SE and MBP-GFP were bound to amylose beads (NEB) by overnight incubation at 4 °C ...
-
bioRxiv - Cell Biology 2020Quote: Recombinant GFP-fusion proteins were purified from BL21(DE3) cells (NEB, # C2527H) using an N-terminal H6-tag ...
-
bioRxiv - Genomics 2023Quote: ... backbone by digesting pAAV-GFP with SpeI-HF (New England Biolabs, R3133S) and XbaI (New England Biolabs ...
-
bioRxiv - Genomics 2020Quote: ... As a control plasmid pCMV6 plasmid (4.6kb) was linearized by digestion with NdeI (NEB, RO111). 180 ng control linearized plasmid DNA and 180 ng of 3C library was treated with either 0.5 Unit exonuclease V (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... Library concentration and quality control were determined using NEBNext Library Quant Kit (New England Biolabs) and Agilent High Sensitivity D1000 ScreenTape System (Agilent ...
-
bioRxiv - Biochemistry 2020Quote: ... together with controls were subject to enzymatic digestion by PNGase F (P0708L, New England Biolabs), Endo H (P0702L ...
-
bioRxiv - Cell Biology 2022Quote: ... and either incubated with buffer control or lambda protein phosphatase (λ) (New England Biolabs; P0753) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... A fully methylated control sample (CpG Methylated HeLa Genomic DNA; New England BioLabs, MA, USA) was included in a random position on each plate to facilitate plate tracking ...
-
bioRxiv - Immunology 2020Quote: ... m6A-positive and m6A-negative control oligonucleotides (EpiMark N6-Methyladenosine Enrichment Kit, New England Biolabs) were spiked into total RNA prior to immunoprecipitation ...
-
bioRxiv - Microbiology 2022Quote: ... Open circular plasmid control was obtained by incubation with the Nt.BspQI nickase (New England Biolabs), and linear plasmid by cleavage with BamHI.
-
bioRxiv - Cancer Biology 2023Quote: ... A negative control treated for 4 hours at 37 °C with RNaseH1 (New England Biolabs) was included for each condition ...
-
bioRxiv - Microbiology 2022Quote: ... pPVM-2A-144-poliovirus-GFP plasmid DNA was linearized with EcoRI (NEB R3101). Purified linear DNA was then used to in vitro transcribe poliovirus plus stranded RNA using MEGAscript™ T7 Transcription Kit (Thermo Fisher Scientific AM1334 ...
-
bioRxiv - Cell Biology 2019Quote: ... and the GFP PCR was digested with AatII and BglII (New England Biolabs). The two fragments were then ligated together (via the AatII digest site ...
-
bioRxiv - Cell Biology 2020Quote: pFA6a-3xHA-FRB-GFP-his3MX6 was generated by Gibson Assembly (New England BioLabs). The 3xHA epitope coding sequence was PCR-amplified from pFA6a-3xHA-hisMX6 (Longtine et al. ...
-
bioRxiv - Genetics 2020Quote: ... This intermediate plasmid product (pLCv2-GFP) was digested with AfeI (NEB, Cat# R0652S) and EcoRI-HF (NEB ...
-
bioRxiv - Cell Biology 2021Quote: His-SpCas9-GFP was expressed in and purified from BL21 (DE3, NEB, C2527H) bacteria as previously described 47 ...
-
bioRxiv - Genomics 2023Quote: ... The CROP-seq-opti-Puro-T2A-GFP was digested by Esp3I (NEB R0734L) at 37 °C for 30 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... into the XLone-GFP backbone (addgene# 96930) digested with SpeI (NEB, Cat# R0133S) and KpnI-HF (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... and T2A-GFP were amplified with Phusion High-Fidelity DNA Polymerase (NEB, USA) using pLJC5-Tmem192-3HA (Addgene ...
-
bioRxiv - Microbiology 2022Quote: Transfection plasmids were constructed by Gibson assembly using NEB Gibson Assembly Master Mix (New England Biolabs). Supplementary Table 1 provides the sequences of all primers used in this study.
-
bioRxiv - Genomics 2022Quote: ... RNA was harvested 72 hours after transfection using the Monarch Total RNA Miniprep Kit (NEB #T2010). mScarlet and HPRT (housekeeping gene for normalization ...
-
bioRxiv - Genomics 2019Quote: Genomic control DNAs were digested to nucleosides by treatment with the Nucleoside Digestion Mix (NEB, M0649S) for 1 h at 37 C ...
-
bioRxiv - Cancer Biology 2020Quote: ... Positive control slides were treated with 3 U/mL DNase-1 (New England Biolabs, Cat. M0303) for 10 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were incubated for 15 min either with PBS (control) or DNase I (10U) (NEB M0303) or RNase A (2mg/mL ...
-
bioRxiv - Plant Biology 2021Quote: ... The inserts were cloned into pLRE::GFP plasmid linearized with BamHI (NEB, Catalog # R0136) and SalI (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... pRS306-GFP-linker-CDC42 plasmid was linearized with PshAI (Cat#R0593S, New England Biolabs) and co-transformed with a PCR product containing the desired K-to-R changes into an uracil auxotrophic strain (PC538) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The Ppa-nhr-10p::GFP construct was linearized with SphI-HF (New England BioLabs) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... Fgfrb-eGFP signal was detected using an anti-GFP antibody (TP401, Torrey Pine Biolabs) in combination with nuclear (Hoechst ...
-
bioRxiv - Molecular Biology 2023Quote: ... Stable cell lines were generated by transfection of piggyBac transposon (PB) and transposase (PBO, Transposagen/Hera BioLabs) plasmids with GeneJuice (Novogene ...
-
bioRxiv - Biochemistry 2020Quote: ... with anti-Knbu/Kibu as the positive control using anti-butyryllysine antibody (PTM Biolabs, Cat# PTM-301) and histone H3 as the loading control using histone H3 antibody (Santa Cruz Biotechnology ...
-
bioRxiv - Microbiology 2023Quote: ... and RpoD control were assessed using the Luna Universal One-Step qRT-PCR kit (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... the pHRRA1-GFP (pKS85) (Table 4) plasmid was PCR-amplified with Phusion HF Polymerase (NEB), using primers designed using the QuikChange Primer Design tool (Agilent) ...
-
bioRxiv - Neuroscience 2020Quote: ... Next, the TRE-90CGG-GFP vector(Hukema et al., 2014) was restricted with SacII (NEB) and the 90xCGG repeat expansion was replaced with the 50x G4C2 repeat expansion ...