Labshake search
Citations for New England Biolabs :
1851 - 1900 of 2293 citations for Mouse D7ERTD443E shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... gigas β/δ82Asn→Lys Hb mutant via site-directed mutagenesis on the Steller’s sea cow Hb expression vector by whole plasmid amplification using mutagenic primers and Phusion High-Fidelity DNA Polymerase (New England BioLabs), phosphorylation with T4 Polynucleotide Kinase (New England BioLabs) ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... 5 µl of the plasmid DNA served as template for a 50 µl PCR (Q5 High-Fidelity 2X Master Mix, NEB) with primers PK412+PK421 (input library ...
-
bioRxiv - Molecular Biology 2023Quote: ... these antibiotic resistant cassettes were excised by transforming the strains with a plasmid expressing the Cre recombinase (pDR244, BGSCID: ECE274) purified from RecA+ Escherichia coli (NEB) cells with the GeneJET Plasmid Miniprep Kit (Thermo) ...
-
bioRxiv - Molecular Biology 2022Quote: ... following the manufacture’s protocol. Plasmids were transformed in DH5-alpha or DH10-beta chemo-competent Escherichia coli (E. coli) cells (New England Biolabs). Transformed bacteria were grown in LB medium supplemented with 50 μg/mL kanamycin or 100 μg/mL carbenicillin ...
-
bioRxiv - Biophysics 2022Quote: ... The PCR product was digested by HindIII and NheI then was cloned into the digested pGJJ162 plasmid using T4 Ligase (NEB). To construct 6 KRAS BindingPCA plasmids ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmid DNAs for each of the 4 constructs were sequentially digested with SacI and BamHI (New England Biolabs, Ipswich, MA), purified by gel electrophoresis ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting PCR product was integrated in the pMV261 (81) plasmid digested with AatII and EcoRI using the Gibson Assembly strategy according to the manufacturer protocol (NEB).
-
bioRxiv - Microbiology 2023Quote: ... PYD and HD mutants were generated from full length IFI207-HA plasmids and the R1-PYD mutant from R1-IFI207 using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). IFI207-HIN plasmids were generated by PCR amplification of the HIN domain from full length IFI207-V5 expression plasmids ...
-
bioRxiv - Microbiology 2023Quote: ... was constructed by PCR amplification of the mCTX2-PexoT-ZTP-lacZ plasmid using the three GA primer pairs (Table 1) followed by NEBuilder assembly (NEB). The resulting PexoT-ZTP(M4)-lacZ reporter fusion was integrated in the P ...
-
bioRxiv - Molecular Biology 2023Quote: All RPL39 variants were cloned into the pRS413-GPD plasmid digested by the BamHI and SalI using the Gibson assembly kit (NEB). Guide blocks (IdT ...
-
bioRxiv - Biophysics 2023Quote: ... The plasmid pJH114 was used to create the plasmid pJH114-ΔB encoding BamACDE by deleting the bamB gene using the Q5 Site-directed mutagenesis kit (New England Biolabs). The bamA gene ...
-
bioRxiv - Biochemistry 2023Quote: ... 100 μg of pSCW01 plasmid was treated with 1.5 units/μg of site specific endonuclease Nt.BstNBI (New England Biolabs, Ipswitch, MA) and 100X molar excess of displacer oligonucleotides (DNA197-199 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The RNA fusion targets were transcribed from plasmids using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, Ipswich, MA), isolated using the Monarch Kit (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: IS element excision from the plasmid backbone was detected by PCR using OneTaq 2X Master Mix with Standard Buffer (NEB) and 0.2 uM primers ...
-
bioRxiv - Genetics 2023Quote: ... The genomic sequence CATGGTATAAAGTGAATCAAGG was targeted by the plasmid pDSP45 which was made from pDD162 (Dickinson et al., 2013) using the Q5 site-directed mutagenesis kit (NEB).
-
bioRxiv - Genetics 2023Quote: ... We next linearized pattB-DSCP-QF#7-hsp70 (Plasmid #46133)123 using BamHI and NsiI and with Gibson Assembly (NEB) cloned R49E06 promoter in the plasmid.
-
bioRxiv - Microbiology 2023Quote: ... cells by introducing either a truncation or a substitution into the parental pFE127 plasmid via site-directed PCR-based mutagenesis (KLD enzyme mix, New England Biolabs). Protein expression was induced for 4 h at 37°C by adding 1 mM IPTG when cell cultures reached OD600 nm ∼0.5 in LB with ampicillin ...
-
bioRxiv - Bioengineering 2023Quote: ... Ligation of the gRNA expression cassette sequence into the pCas9-amdSYM plasmid was made using a T4 DNA ligase (NEB). Yeast cells were transformed using the yeast transformation procedure described in [14] and selected on YNB Acetamide plates (1.7 g/L yeast nitrogen base without amino acids and nitrogen (Euromedex) ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR product was cloned into the tetracycline inducible plasmid pRMC226 using KpnI and SacI restriction sites and T4 DNA ligase (NEB). This was transformed into RN4220 and eventually into the respective NTML mutants through electroporation.
-
bioRxiv - Synthetic Biology 2023Quote: ... was then done with the homologies to construct the initial green fluorescent protein (GFP) plasmid and then transformed into competent E.coli (NEB#C2984H) and subsequently sequenced (Plasmidsaurus ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The origin of replication and antibiotic resistance gene fragments were obtained from source plasmids by PCR amplification with Q5 HiFi DNA polymerase (NEB). The multiple cloning site ...
-
bioRxiv - Bioengineering 2023Quote: ... TADs were directly fused to the N-terminus to dCas9 by digesting the FLAG-NLS-MCS-linker-dCas9 plasmid with AgeI (NEB) and then cloning in PCR-amplified TADs using NEBuilder HiFi DNA Assembly ...
-
bioRxiv - Cell Biology 2023Quote: ... Site-specific mutagenesis of double-stranded plasmid DNAs were constructed using the Q5 Site-Directed Mutagenesis Kit (E0554S, New England Biolabs), according to the manufacturer’s instructions.
-
bioRxiv - Bioengineering 2023Quote: Double-stranded linear DNA template for HDR and electroporation was amplified from plasmid DNA by PCR using Q5 High-Fidelity Master Mix (New England Biolabs) according to manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2023Quote: ... The 2 pairs of ends were then ligated simultaneously to the linearized plasmid using T4 DNA Ligase (New England Biolabs:M0202) at 2 U/pmol DNA ends in 1x T4 ligase buffer (provided with enzyme) ...
-
bioRxiv - Microbiology 2023Quote: ... PCR amplified target genes and pQE60 plasmid (containing an IPTG inducible T5 promoter) were digested with BamHI and HinDIII (New England Biolabs) and purified by gel extraction (MinElute gel extraction kit ...
-
bioRxiv - Microbiology 2023Quote: ... or BamHI/SalI for pDL277 and the genes of interest were ligated into the respective plasmids with T4 DNA ligase (NEB). Additionally ...
-
bioRxiv - Genetics 2023Quote: Purified PCR products and enzyme digested plasmid were then ligated together in a gibson reaction using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) according to the manufacturer’s protocol resulting in pUC19-3xP3-DsRed-attB-Gypsy-MCS-no-BbsI ...
-
bioRxiv - Microbiology 2023Quote: ... were amplified using primers 1632/1633 and 1634/1324 and sequentially cloned and inserted into the PbC-3XHA-mCherry hDHFR plasmid at XhoI/BglII and NotI/AscI (NEB), respectively ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Sequence-verified sub-part plasmids are then used as inputs for assembly into carbenicillin-resistant entry vectors using BsaI-v2 HF (NEB) to yield genetic part plasmids (i.e. ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the coding sequence of mCherry and eGFP sequence were linked into the pminiTol2 plasmid with a Gibson cloning kit (New England Biolabs) to generate pmini-eGFP-Lefty-Gdf1/3-like-mCherry construct ...
-
bioRxiv - Biochemistry 2022Quote: ... Inserts were then digested according to manufacturer’s protocol with Nsi-I HF and Hind-III HF and ligated into a calf-intestinal phosphatase treated plasmid using T4 DNA ligase (New England Biolabs). The resulting recombinant plasmid contained an ampicillin resistance cassette and the riboswitch insert located upstream of the fluorescent reporter protein mNeonGreen.79 The plasmid’s transcription is controlled by the moderately strong synthetic promotor ‘proD’80 which has previously been used to study the env8 class-II Cbl riboswitch.59 ...
-
bioRxiv - Biochemistry 2023Quote: ... sgRNA of NmeCas9 was synthesized by in vitro transcription with T7 RNA polymerase and plasmid DNA templates linearized by HindIII-HF (New England Biolabs). The sgRNA sequence was listed in Supplementary Table S1 ...
-
bioRxiv - Biochemistry 2022Quote: ... The abasic site interstrand cross-link (ICLAP)-containing duplexes were ligated into the linearized plasmid backbone using T4 DNA ligase (NEB). The ligated plasmid was dialyzed into TE pH 8.0 buffer and concentrated using an Amicon Ultra-15 10 kDa molecular weight cut-off filter unit ...
-
bioRxiv - Biophysics 2023Quote: All integration and 2μ plasmids were constructed based on the pJLA vectors using either restriction digest and ligation method with T4 DNA ligase (NEB), or In-Fusion HD cloning kit (Takara Bio) ...
-
bioRxiv - Biochemistry 2022Quote: ... 50 μg of supercoiled pUBER plasmid was treated with 1 unit/μg Nt.BbvCI in 1 × Cutsmart buffer (New England Biolabs, USA) at 37°C for 4 h ...
-
bioRxiv - Bioengineering 2023Quote: ... in vitro transcription (used in experiments in figures otherwise) from the SB100x plasmid using the HiScribe T7 ARCA mRNA (with tailing) Kit (NEB). Following RNA transcription in vitro ...
-
bioRxiv - Synthetic Biology 2022Quote: ... to construct a set of plasmids (pOSV00169, pOSV00205, pOSV00206, pOSV00207, pOS00208, pOSV00292, pOSV00459 and pOSV00475) using restriction enzymes BamHI-HF (New England Biolabs) and EcoRI-HF (New England Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: ... was introduced into an existing pZDonor-AAVS1-CAG-HA-KLF1-ERT2-PolyA plasmid (28) via site-directed mutagenesis using the Q5 Site-Directed Mutagenesis Kit (E0554S, New England BioLabs) following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... two identical Golden Gate Assembly reactions were carried out by mixing 7 μl of each ∼ 20 nM DT4 plasmid and ∼ 20 nM ligator fragment with 1 μl of Golden Gate Mix (New England Biolabs) in T4 DNA Ligase Buffer (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The six PCR products were then inserted into the ClaI-digested plasmid in a single reaction with NEBuilder (NEB, #M5520AA). All cloning products were verified by control restriction digestion and Sanger sequencing ...
-
bioRxiv - Cancer Biology 2023Quote: ... The plasmid already containing MLANA and λN-ADAR2DD(-NLS) was opened by restriction digestion with the enzyme ClaI (NEB, #R0197). The six PCR products were then inserted into the ClaI-digested plasmid in a single reaction with NEBuilder (NEB ...
-
bioRxiv - Biophysics 2022Quote: ... The HiBit-Hsp70 insert was PCR-amplified directly from pEGFP-Hsp70 plasmid using primers containing the HiBit sequence and then inserted using AgeI and XbaI (NEB), which is SpeI compatible ...
-
bioRxiv - Biophysics 2022Quote: ... 1 μM Casπ RNP effectors were incubated with 20 nM target plasmids at 37 °C for 30 min and then quenched with loading buffer (Gel Loading Dye Purple 6X, NEB) supplemented with 20 mM EDTA and 25 μg/ml heparin ...
-
bioRxiv - Genetics 2023Quote: ... The PCR products were gel-purified and then assembled into a plasmid backbone digested with MluI (New England BioLabs, R3198S) and SpeI (New England BioLabs ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCR reaction and digested plasmid were gel purified and used to perform a Gibson Assembly reaction (Cat. #E2611S, New England Biolabs) followed by bacterial transformation according to the manufacturer instructions ...
-
bioRxiv - Immunology 2023Quote: ... The CAR backbone constructs were ordered as gBlock (IDT) and cloned into the LZRS-IRES-eGFP retroviral plasmid by Gibson Assembly (NEBuilder HiFi DNA Assembly Master Mix) (NEB). The VHH specific sequence was amplified using PCR (Phusion High Fidelity PCR kit ...
-
bioRxiv - Developmental Biology 2023Quote: ... The loxP-dsRed-loxP fragment and the above modified pJet1.2 plasmid were digested with the restriction enzymes AgeI (NEB, R0552S) and PacI (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... have been obtained by gBlock gene fragments synthesis (IDT) and subsequently cloned into a plasmid backbone via Gibson assembly protocol (New England Biolabs) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: Control and DRP1 gRNA were cloned into a plasmid containing a U6 promoter using BstXI and BlpI restriction enzymes (NEB) (gifted by Dr ...