Labshake search
Citations for New England Biolabs :
8701 - 8750 of 9943 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... Strand specific mRNA libraries were generated using the NEBNext Ultra II Directional RNA library prep Kit for Illumina (New England BioLabs #E7760), mRNA was isolated using Poly(A ...
-
bioRxiv - Plant Biology 2024Quote: ... downstream of the constitutive 35S promoter and upstream of the start codon of the GUS reporter using HiFi DNA assembly cloning kit (NEB E5520). Fragments of 35S promoter + vector backbone + GUS was amplified using forward primer ATGTTACGTCCTGTAGAAACCC and reverse primer GTCGACTCCAAATGAAATGAAC ...
-
bioRxiv - Developmental Biology 2024Quote: ... three sgRNAs for skp2 were designed and synthesized in vitro using HiScribe™ T7 High Yield RNA Synthesis Kit(NEB, E2040S). The Cas9-sgRNA ribonucleoprotein complex (RNP ...
-
bioRxiv - Genomics 2024Quote: ... Zirconium beads (3.0mm) in a bead beater were used to homogenize mosquitoes before proceeding with NEB Monarch Total RNA Miniprep Kit (NEB #T2010). The on-column DNase I treatment was performed during RNA extraction ...
-
A humoral immune response to parasitoid wasps in Drosophila is regulated by JAK/STAT, NF-κB and GATAbioRxiv - Immunology 2024Quote: ... RNAseq libraries were then prepared using a NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs #E7760S) with NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs ...
-
bioRxiv - Genetics 2024Quote: ... TLK1 and TLK2 point mutants were generated by site-directed mutagenesis reactions using the NEB Q5 site-directed mutagenesis kit (NEB, E0554S). Primers are listed in Supplementary Table 1.
-
bioRxiv - Pathology 2024Quote: Sequencing library was generated from total mRNA (1 µg) using NEBNext UltraTM RNA Library Prep Kits for Illumina (New England BioLabs, MA). cDNA libraries were sequenced by a NovaSeq 6000 (Illumina ...
-
bioRxiv - Neuroscience 2024Quote: ... was used to construct sequencing libraries using the NEBNext Ultra II DNA library prep kit for Illumina (New England Biolabs, NEB). Libraries were multiplexed using NEBNext Multiplex Oligos for Illumina (dual index primers ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 ng of ChIP and Input DNA was used to generate ChIP-seq libraries using the NEBNext Ultra DNA library prep kit for Illumina (New England Biolabs, NEB).
-
bioRxiv - Genomics 2024Quote: ... 1 µg of genomic DNA was pooled with 1:20 dilutions of unmethylated lambda (1 µl of 0.1 ng/µl) and methylated pUC19 control DNA (1 ul of 0.005 ng/µl) from the EM-seq kit (E7120L; NEB, Ipswich, MA). Volumes were made up to 50 ul with 0.1x TE buffer (Sigma-Aldrich ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Reverse transcription (1 µg total RNA or 500 ng at lower concentrations) was performed using the ProtoScript II First Strand cDNA Synthesis Kit (NEB, E6560L), resulting in cDNA concentrations of 50 and 25 ng/µL ...
-
bioRxiv - Cell Biology 2024Quote: ... The PCR products were introduced into linearised PLX311 template vector using NEBuilder® HiFi DNA Assembly Cloning kit (New England Biolabs). All constructs were sequence-verified.
-
bioRxiv - Genetics 2024Quote: ... and up to 1 μg was reverse transcribed to cDNA using the ProtoScript II First Strand cDNA Synthesis Kit (NEB, Cat.E6560) following manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... PCR reactions were purified by DNA agarose gel electrophoresis and subsequent DNA extraction using Monarch DNA Gel Extraction Kit (New England Biolabs (NEB)).
-
High-resolution profiling reveals coupled transcriptional and translational regulation of transgenesbioRxiv - Synthetic Biology 2024Quote: ... Synthesized modRNA was column purified and eluted with 60 µL water using the 50 µg Monarch RNA Cleanup Kit (New England Biolabs, T2040). A small sample was nanodropped and ran on a native denaturing gel to determine modRNA concentration and verify full-length product ...
-
High-resolution profiling reveals coupled transcriptional and translational regulation of transgenesbioRxiv - Synthetic Biology 2024Quote: ... 200 ng of purified product served as template in a 20 µL IVT reaction using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs, E2040), fully substituting UTP with N1-methylpseudouridine-5’-triphosphate (TriLink Biotechnologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR and digest products were purified using Monarch DNA Gel Extraction and PCR and DNA Clean Up Kits (NEB T1020S, T1030S).
-
bioRxiv - Molecular Biology 2024Quote: Plasmids (pBluescript KS+, pBS hereon) for HiBit-tagged POI mRNA were generated by Gibson Assembly (Gibson Assembly cloning kit, NEB, E5510S) or restriction digest cloning ...
-
bioRxiv - Molecular Biology 2024Quote: Nuclear RNA-seq libraries were prepared from DNA-free nuclear RNA using NEBNext® UltraTM II Directional RNA Library Prep Kit (NEB) after first depleting rRNA using the NEBNext® rRNA Depletion Kit v2 (Human/Mouse/Rat) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Linearized DNAs were used as templates for in vitro transcription of capped RNAs with HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs) in the presence of CleanCap® Reagent AU (TriLink Biotechnologies) ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR amplicons of the expected size were excised from the gel and purified using Monarch® DNA Gel Extraction Kit (New England Biolabs). Purified PCR amplicons were subjected to Sanger sequencing carried out by The Australian Genome Research Facility (AGRF ...
-
High-resolution profiling reveals coupled transcriptional and translational regulation of transgenesbioRxiv - Synthetic Biology 2024Quote: ... cDNA was synthesized from 6 µL of eluted RNA using the ProtoScript First Strand cDNA Synthesis Kit (New England Biolabs, E6300) with oligo-dT primers ...
-
bioRxiv - Cell Biology 2024Quote: ... The RNA-Seq library-preparation protocol was based on the NEBNext Ultra™ RNA Library Prep Kit for Illumina (NEB, #E7530L). Insert size was assessed using the Agilent Bioanalyzer 2100 system and qualified insert size was accurate quantification using StepOnePlus™ Real-Time PCR System (Library valid concentration>10nM ...
-
bioRxiv - Plant Biology 2024Quote: ... Site-directed mutagenesis was performed to generate the AeCRKG359E (inactive kinase mutation) and AeRLCK2G110E (rlck2-6 mutant allele mutation) variants using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs). The primers used were AeCRKkin_Mut_G359E_F and AeCRKkin_Mut_G359E_R and the AeRLCK2mutL42F and AeRLCKmutL42R ...
-
bioRxiv - Systems Biology 2024Quote: ... 10 ng nuclear RNA and 100 ng whole-cell RNA was used as template for RT-qPCR using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005). PCR was performed per manufacturer recommendations ...
-
bioRxiv - Systems Biology 2024Quote: ... Total RNA was extracted from each sample (+/- SIRLOIN/TSO, nuclei and whole cells, 4 samples total) with the NEB Total RNA Miniprep kit (NEB #T2010). 10 ng nuclear RNA and 100 ng whole-cell RNA was used as template for RT-qPCR using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005) ...
-
bioRxiv - Pathology 2024Quote: ... Amplified crRNA dsDNA was gel purified and eluted and subsequently used for in vitro crRNA synthesis following the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs, Germany). CrRNA was synthesized from dsDNA template by overnight incubation at 37°C using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs ...
-
bioRxiv - Microbiology 2024Quote: ... The “co-culture” RNA sample was treated with an NEBNext® Poly(A) mRNA Magnetic Isolation kit (New England Biolabs, UK), and 100 µl of the produced supernatant (bacterial fraction ...
-
bioRxiv - Microbiology 2024Quote: ... the RNA was standardized for cDNA conversion utilizing the ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs, Massachusetts, USA) following the provided protocol ...
-
bioRxiv - Microbiology 2024Quote: ... and cloned into pMOTag2T already containing a puromycin resistance marker and one copy of the Ty1 tag (63) by XhoI site using NEBuilder® HiFi DNA Assembly cloning kit (New England Biolabs). The Donor DNA provided to induce homology-directed repair contained a 3x-Ty1 tag ...
-
bioRxiv - Microbiology 2024Quote: ... and dominant negative RabD2T91N (RabD2TN) primers (forward primer 5’TGTTGGTAAAAACTGTTGTATGAATAGATATGTTAG3’ reverse primer 5’GAAGACTCTCCTACCATAATAAC3’) using Q5 Site-directed mutagenesis kit (E0554S New England Biolabs, USA) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Size-selected and adapter-ligated DNA was enriched via PCR using the NEBNext Ultra II DNA Library Prep Kit for Illumina with the NEBNext Multiplex Oligos for Illumina as dual index primers (New England BioLabs Inc.). A final metagenome pool was sent for sequencing at Novogene Corporation Inc ...
-
bioRxiv - Molecular Biology 2024Quote: ... and for Figure 2 using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA, USA). Input DNA was also used as a control ...
-
bioRxiv - Molecular Biology 2024Quote: ... A total of 200 ng RNA was used for library construction using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, #E7760), together with the NEBNext Poly(A ...
-
bioRxiv - Neuroscience 2024Quote: ... In brief RNA-seq libraries were prepared from total RNA using polyA selection followed by the NEBNext Ultra II Directional RNA Library Prep Kit protocol (New England Biolabs, E7760S). Sequencing was performed on Illumina HiSeq 2500 instrument resulting in approximately 30 million 50 bp reads per sample ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs; Ipswich, MA). RNA sequencing was performed on an Illumina NovaSeq6000 system with 100x coverage.
-
bioRxiv - Neuroscience 2024Quote: Total RNA samples were prepared into RNAseq libraries using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England BioLabs E7760L) following manufacturer’s recommended protocol ...
-
bioRxiv - Neuroscience 2024Quote: Libraries for CUT&RUN samples were prepared using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, cat# E7645S) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Poly(A)-enriched RNA-Seq libraries were generated using the NEBNext Ultra II RNA Library Prep Kit for Illumina (New England Biolabs, E7770), and analyzed on a NovaSeq S4 PE150 XP platform by the NGS Facility at VBCF ...
-
bioRxiv - Systems Biology 2024Quote: ... Both the lentiviral plasmid and the PCR amplicon were double digested with ClaI (R0197S) and SalI (R3138S) and processed with a PCR & DNA cleanup kit (NEB T1030S). To generate the EGFP reporter ...
-
bioRxiv - Physiology 2024Quote: ... cDNA was obtained by reverse transcription of total RNA using an Lunascript® RT Supermix cDNA synthesis kit (New England Biolabs). cDNA products were detected using an iQ SYBR Green Supermix (Bio-Rad Laboratories ...
-
bioRxiv - Genomics 2024Quote: ... Immunoprecipitated DNA was reverse-crosslinked and used to construct high-throughput sequencing libraries using NEBNext Ultra DNA Library Prep Kit (New England Biolabs, E7370). DNA libraries were processed on an Illumina HiSeq machine for single-end 50-nt sequencing ...
-
bioRxiv - Neuroscience 2024Quote: All plasmids were custom designed and constructed with a modified mMoClo system.44 Parts were cloned with Bsa1 adapters and assembled into expression constructs with a NEB Golden Gate Assembly Kit (NEB #E1602). Plasmids were transformed into One Shot TOP10 (Thermo Fisher C404006 ...
-
bioRxiv - Microbiology 2024Quote: PCR amplified transformation cassettes were purified by column purification (Monarch PCR and DNA Cleanup Kit, New England Biolabs, Ipswich, MA, USA) prior the use for fungal transformation of A ...
-
bioRxiv - Microbiology 2024Quote: Tax1bp1 was amplified by PCR from murine cDNA using the primers named Tax1bp1 fwd and rev (Table 2) and inserted by ligation-independent cloning (NEBuilder Builder HiFi DNA Assembly Cloning Kit, NEB #E5520S) into pENTR1A no ccdB (w48-1 ...
-
bioRxiv - Microbiology 2024Quote: ... and genomic DNA was purified with phenol-chloroform extraction and Monarch® Genomic DNA Purification Kit (New England Biolabs, MA, USA) [12 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The digestion products from the pR probes were purified with the Monarch PCR & DNA Cleanup Kit (New England Biolabs, Cat# T1030L) to serve as the vector ...
-
bioRxiv - Immunology 2024Quote: ... Primers for each were designed from PrimerBank for mouse and qRT-PCR was performed as a one step Sybr Green reaction using Luna kits (NEB, MA)
-
bioRxiv - Immunology 2024Quote: ... The linearized plasmids were used as a template for in vitro transcription (IVT) using a T7 High Yield RNA Synthesis Kit (New England Biolabs, E2040). For the modified linear RNA ...
-
bioRxiv - Microbiology 2024Quote: ... were all ligated together using the NEB Hi-Fi DNA assembly kit according to the manufacturer’s instructions (New England Biolabs, Ipswich, MA). These plasmids were introduced into B ...