Labshake search
Citations for New England Biolabs :
8651 - 8700 of 9943 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The 2X FLAG sequence was introduced via PCR as an oligonucleotide primer along with a reverse primer that produced the 3’ CNA1 UTR and cloned by use of the Gibson Assembly Cloning Kit (NEB #E5510S). The identity of the vector pCnat-CNA1-2X FLAG was also confirmed by sequencing.
-
bioRxiv - Microbiology 2023Quote: ... Sequence libraries were prepared with the NEBNext Ultra II FS DNA Library Prep 136 kit (New England Biolabs GmbH, Frankfurt, Germany) and sequenced with the NovaSeq6000 (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA was used to prepare poly-A selected directional libraries using the NEB Next Ultra Directional RNA Library Prep Kit (New England BioLabs, USA) and libraries were sequenced utilizing the Illumina Hiseq2000 platform at the sequencing core facility of the Max Planck Institute of Immunology and epigenetics (Freiburg ...
-
bioRxiv - Molecular Biology 2023Quote: ... peptide sequences specific to an aMino sdAb were generated using the Ph.D.™-C7C Phage Display Peptide Library Kit (New England BioLabs, E8120S), a combinatorial library consisting of randomized display peptides with a disulphide constrained loop (AC-XXXXXXX-CGGGS ...
-
bioRxiv - Plant Biology 2024Quote: ... cDNA libraries were prepared by reverse transcribed total RNA using a ProtoScript® II First Strand cDNA Synthesis Kit (NEB, #E6560) with d(T)23 VN oligo and sent to Novogene for sequencing using Illumina Novaseq 6000 (PE 150bp with 6Gb read depth coverage).
-
bioRxiv - Microbiology 2024Quote: ... Input control and HT-enriched samples were prepared for Illumina sequencing using NEBNext Ultra II Library Prep Kit for Illumina (NEB; E7645S) following manufacturer’s protocol and sequenced on Illumina NovaSeq 6000 2×150 with the UW-Madison Biotechnology Center at ∼10 million reads per sample.
-
bioRxiv - Genetics 2024Quote: Total RNA from mouse glomeruli was sequenced on a HiSeq 4000 following standard workflow using NEBNext Ultra II RNA Library Preparation kit (New Englab Biolabs, MA)(Illumina ...
-
Genetic gradual reduction of OGT activity unveils the essential role of O-GlcNAc in the mouse embryobioRxiv - Developmental Biology 2024Quote: ... Library preparation was performed by EMBL Genomics Core Facility using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760L), in combination with the NEBNext Poly(A ...
-
Genetic gradual reduction of OGT activity unveils the essential role of O-GlcNAc in the mouse embryobioRxiv - Developmental Biology 2024Quote: ... RNA was then extracted by adding an equal volume of RNA lysis buffer and proceeding with Monarch Total RNA Miniprep Kit (NEB #T2010S) extraction ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Barcoded mutant variants were then cloned into the cut vector using the NEBuilder HiFi DNA Assembly Kit (NEB, Cat. No. E2621) with a 1:3 insert to vector molar ratio in a 1 hour reaction ...
-
bioRxiv - Developmental Biology 2024Quote: ... pMT-mCherry-Rlip and pMT-Rlip-mCherry were cloned from pMT-Rlip-HA using NEB HiFi Assembly kit (NEB cat#E5520) to exclude the retained intron and incorporate the mCherry open reading frame into pMT-V5-His vector ...
-
bioRxiv - Developmental Biology 2024Quote: ... The molecular barcoded ChIP-seq library was prepared with all ChIPed-DNA obtained using the NEBNext UltraII DNA library Prep kit (NEB, E7645S). The quality of the libraries was assessed on a Bioanalyzer (Agilent) ...
-
bioRxiv - Developmental Biology 2024Quote: ... the corresponding sgRNA was designed online (https://benchling.com) and was synthesized by using the HiScribe™ T7 RNA Synthesis Kit (NEB, E2050). The purified RNA and Cas9 protein (Cat1081058 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 500 ng total RNA was used as template with the Luna Universal One-step RT-qPCR kit (New England Biolabs, E3005L). For each condition 3 biological replicates with two technical replicate RT-qPCR reactions were run on a CFX96 Connect Real-Time System (BioRad) ...
-
bioRxiv - Cell Biology 2024Quote: ... The RNA-Seq library-preparation protocol was based on the NEBNext Ultra™ RNA Library Prep Kit for Illumina (NEB, #E7530L). Insert size was assessed using the Agilent Bioanalyzer 2100 system and qualified insert size was accurate quantification using StepOnePlus™ Real-Time PCR System (Library valid concentration>10nM ...
-
bioRxiv - Neuroscience 2024Quote: ... was used to construct sequencing libraries using the NEBNext Ultra II DNA library prep kit for Illumina (New England Biolabs, NEB). Libraries were multiplexed using NEBNext Multiplex Oligos for Illumina (dual index primers ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 ng of ChIP and Input DNA was used to generate ChIP-seq libraries using the NEBNext Ultra DNA library prep kit for Illumina (New England Biolabs, NEB).
-
bioRxiv - Cell Biology 2024Quote: ... Every 2 PCR reactions were pooled and purified in 100ul elution buffer using Monarch PCR & DNA Cleanup Kit (7:1 binding buffer, NEB#T1030L). 5ul/reaction Dynabeads M270 Streptavidin (Thermofisher#65305 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Ribosome-depleted RNA was used to make cDNA libraries using NEBNext Ultra II RNA Library preparation kit for Illumina and NEBNext Multiplex Oligos for Illumina as per manufacturer’s protocol (New England Biolabs, Ipswich, MA). Briefly ...
-
bioRxiv - Genomics 2024Quote: ... The reaction was purified using the Zymo DNA Clean & Concentrator kit and PCR-amplified with NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L) and primers as defined in Corces et al ...
-
bioRxiv - Microbiology 2024Quote: ... and utilized for library constructions with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina along with NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs; NEB; # E7760L). The libraries were sequenced on the NovaSeq platform as paired-end reads using the S1 v1.5 kit with 300 cycles (Illumina) ...
-
bioRxiv - Genomics 2024Quote: ... Illumina libraries were constructed from total RNA using the NEB Next Ultra Directional RNA Library Prep Kit (New England Biolabs, E7760) per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... 500 ng of RNA were retrotranscribed into cDNA using a LunaScript™ RT SuperMix cDNA Synthesis Kit (NEB, Cat. No. E3010L) using the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... The mixture was incubated for 3 days at 37C in the dark for conjugation and purified for 3 rounds using Monarch PCR & DNA Cleanup Kit (5 µg) (NEB, T1030S) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... 1 µg of genomic DNA was pooled with 1:20 dilutions of unmethylated lambda (1 µl of 0.1 ng/µl) and methylated pUC19 control DNA (1 ul of 0.005 ng/µl) from the EM-seq kit (E7120L; NEB, Ipswich, MA). Volumes were made up to 50 ul with 0.1x TE buffer (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2024Quote: ... downstream of the constitutive 35S promoter and upstream of the start codon of the GUS reporter using HiFi DNA assembly cloning kit (NEB E5520). Fragments of 35S promoter + vector backbone + GUS was amplified using forward primer ATGTTACGTCCTGTAGAAACCC and reverse primer GTCGACTCCAAATGAAATGAAC ...
-
bioRxiv - Genomics 2024Quote: ... Zirconium beads (3.0mm) in a bead beater were used to homogenize mosquitoes before proceeding with NEB Monarch Total RNA Miniprep Kit (NEB #T2010). The on-column DNase I treatment was performed during RNA extraction ...
-
bioRxiv - Pathology 2024Quote: Sequencing library was generated from total mRNA (1 µg) using NEBNext UltraTM RNA Library Prep Kits for Illumina (New England BioLabs, MA). cDNA libraries were sequenced by a NovaSeq 6000 (Illumina ...
-
bioRxiv - Cell Biology 2024Quote: RNA encoding indicated HSP90B1 nascent chains were prepared from PCR amplified and purified DNA template containing a T7 promoter and carried out at 37°C for 2 hours using the HiScribe® T7 High Yield RNA Synthesis Kit (New England Biolabs) and purified using the RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2024Quote: ... C1-deleted pMYs-CIC::DUX4-IRES-EGFP was cloned from pMYs-CIC::DUX4-IRES-EGFP (a gift from Takuro Nakamura (52) and Michael Kyba (25)) using the Q5 Site-Directed Mutagenesis Kit (NEB E0554S) with the primers described in Supplemental Dataset S2 ...
-
bioRxiv - Cell Biology 2024Quote: ... Individually barcoded strand-specific libraries for mRNA sequencing were prepared from total RNA samples of high quality (approximately 150 ng per sample) using the NEBNext® RNA Ultra II Directional RNA Library Prep Kit (New England Biolabs) for 12 PCR cycles on the liquid handler Biomek i7 (Beckman Coulter GmbH ...
-
A humoral immune response to parasitoid wasps in Drosophila is regulated by JAK/STAT, NF-κB and GATAbioRxiv - Immunology 2024Quote: ... RNAseq libraries were then prepared using a NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs #E7760S) with NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs ...
-
bioRxiv - Cell Biology 2024Quote: The deadenylase dead mutation (D1020A) in PAN2’s coding sequence was generated by site-directed mutagenesis (Q5 Site Directed Mutagenesis Kit from NEB E0554) with primer pairs 5’ GGTTTGAATAATGCCTTCAAACACATTAATATTAATGTC 3’ and 5’ ATGACCAACAAATACATTATTCAAACCATGACCAAC 3’ ...
-
bioRxiv - Genetics 2024Quote: ... TLK1 and TLK2 point mutants were generated by site-directed mutagenesis reactions using the NEB Q5 site-directed mutagenesis kit (NEB, E0554S). Primers are listed in Supplementary Table 1.
-
bioRxiv - Genetics 2024Quote: ... and 0.5–50 ng of DNA/ChIP was used for library preparation using the NEBNext Ultra II DNA Library Kit for Illumina (NEB E7645) and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 and 2 ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µg of RNA was used as input for library preparation using the NEBNext Multiplex Small RNA Library Prep Kit for Illumina (NEB E7560S), according to the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was collected from parental iOvCa147 cells and DYRK1A-/-cells from 24-hour adherent or 6-hour spheroid conditions using the Monarch Total RNA Miniprep Kit (NEB #T2010S) as described above ...
-
bioRxiv - Cancer Biology 2024Quote: ... with 1 µg of total RNA used for sequencing library construction with NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, USA). Raw FastQ files were mapped using Bbsplit from the Bbtools 39.01 suite against Mm10 and hg38 (31 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The spheres were collected after 24 h and RNA extracted using the Monarch Total RNA Miniprep Kit (New England Biolabs #T2010S). RNA was extracted from adherent cells directly from the plate ...
-
bioRxiv - Cell Biology 2024Quote: ... The Tg-FLAG gene was then amplified and assembled with an empty pcDNA5/FRT expression vector using a HiFi DNA assembly kit (New England BioLabs, E2621). This plasmid then underwent site-directed mutagenesis to produce pcDNA5-C1264R-Tg-FLAG ...
-
bioRxiv - Microbiology 2024Quote: RdnE proteins were produced using the New England Biolabs PURExpress In Vitro Protein Synthesis Kit (New England BioLabs Inc., Ipswich MA). Template DNA contained the rdnE gene and required elements specified by the PURExpress kit ...
-
bioRxiv - Molecular Biology 2024Quote: ... mRNA sequencing libraries were generated using the poly-A selection module in the NEBNext UltraII Directional RNA Library Prep Kit (NEB E7760) and sequenced on the Illumina HiSeq 2500 sequencer with single-end 50 cycles ...
-
bioRxiv - Developmental Biology 2024Quote: ... mRNA isolation module for samples with RINs greater than 7 and libraries were prepared using the NEBNext Ultra II directional RNA library preparation kit (NEB, E7760). QC was then performed on these libraries using an Agilent Bioanalyzer 2100 and the libraries were quantified using fluorometric methods ...
-
bioRxiv - Developmental Biology 2024Quote: ... three sgRNAs for skp2 were designed and synthesized in vitro using HiScribe™ T7 High Yield RNA Synthesis Kit(NEB, E2040S). The Cas9-sgRNA ribonucleoprotein complex (RNP ...
-
bioRxiv - Developmental Biology 2024Quote: ... Amplification of cDNAs was performed using a high-fidelity KOD-Plus-Neo DNA polymerase (Toyobo, Japan) and resulting PCR products were cloned using NEB® PCR Cloning kit (New England BioLabs). Positive clones and plasmids were verified by DNA sequencing.
-
bioRxiv - Immunology 2024Quote: ... Pathogenic ADA2 variants were created by site-directed mutagenesis using the Q5® Site-Directed Mutagenesis Kit (#E0554; New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2024Quote: ... Strand specific mRNA libraries were generated using the NEBNext Ultra II Directional RNA library prep Kit for Illumina (New England BioLabs #E7760), mRNA was isolated using Poly(A ...
-
bioRxiv - Molecular Biology 2024Quote: Nuclear RNA-seq libraries were prepared from DNA-free nuclear RNA using NEBNext® UltraTM II Directional RNA Library Prep Kit (NEB) after first depleting rRNA using the NEBNext® rRNA Depletion Kit v2 (Human/Mouse/Rat) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Linearized DNAs were used as templates for in vitro transcription of capped RNAs with HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs) in the presence of CleanCap® Reagent AU (TriLink Biotechnologies) ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR and digest products were purified using Monarch DNA Gel Extraction and PCR and DNA Clean Up Kits (NEB T1020S, T1030S).