Labshake search
Citations for New England Biolabs :
8501 - 8550 of 9943 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... Purified RNAs were used for Illumina RNA-seq library preparation with NEBNext Ultra II Directional RNA Library Prep Kit (NEB, E7765), and a minimum of 20 million raw reads were obtained ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Purification of PCR products for downstream applications was accomplished using either phenol/chloroform ethanol precipitation or the Monarch® PCR & DNA Cleanup Kit (New England Biolabs) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: ... using the NEBNext Poly(A) mRNA Magnetic Isolation Module and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Immunology 2023Quote: Total RNA was extracted from 107 hybridoma cells using the MonarchTM total RNA extraction kit (New England BioLabs, Ipswich, MA, USA) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... was used to construct sequencing libraries using the NEBNext Ultra II DNA library preparation kit for Illumina (New England Biolabs; #E7760). Libraries were multiplexed using NEBNext Multiplex Oligos for Illumina (dual index primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... 8 µl of the PCR-amplified product was employed for in vitro transcription using the NEB HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs, E2040S), with incubation at 37 °C for 18 hours in a thermocycler ...
-
bioRxiv - Microbiology 2023Quote: ... The NGS library preparation was carried out using the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB, USA), which performs fragmentation ...
-
bioRxiv - Molecular Biology 2023Quote: ... adaptor ligation and PCR indexing was performed on the denatured amplicons using NEB Next Ultra II DNA library prep kit for Illumina (New England Biolabs, UK). The resulting FASTQ files from RNP treated samples for each of the off target amplicons were analysed for indels through CRISPResso2 webtool [45] by comparing them with untreated samples.
-
bioRxiv - Immunology 2023Quote: ... Base editors were cloned into the IVT template vector using NEBuilder® HiFi DNA Assembly Cloning Kit (New England Biolabs, #E5520S) (Extended Data Table 5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The resulting fragment was then inserted into XhoI and NdeI digested pET21a vector by NEBuilder HiFi DNA Assembly Cloning Kit (NEB, E5520). As a result ...
-
bioRxiv - Molecular Biology 2023Quote: ... were grown out in LB medium with 50 µg/mL Kanamycin and then pelleted before plasmids were isolated using the Monarch Plasmid Miniprep Kit (NEB, T1010L). Plasmids were sequenced (Sanger ...
-
bioRxiv - Molecular Biology 2023Quote: ... The specimens were then incubated with a 20-fold diluted Quick Ligase in 1x Quick Ligase Reaction Buffer from Quick Ligation Kit (New England Biolabs, M2200), supplemented with an additional 1 mM ATP (TAKARA Bio ...
-
bioRxiv - Molecular Biology 2023Quote: ChIP libraries were generated with input and pulldown DNA using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB E7645L) for sequencing on an Illumina Nextseq with 75-bp read length and single-end.
-
bioRxiv - Molecular Biology 2023Quote: ... of extracted RNA (either from whole-cell lysates or sucrose gradient fractions) was performed using the ProtoScript II First Strand cDNA Synthesis Kit (NEB E6560L) according to the manufacturer instructions with some modifications ...
-
bioRxiv - Molecular Biology 2023Quote: ... W165F and S169A) were introduced into human PSEN1 cDNA cloned into the pMSCVpuro vector using Q5 Site-Directed Mutagenesis Kit (NEB BioLabs) according to the standard protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... The gene of the mCherry fluorescent protein was inserted into the pHERD20T plasmid according to the manufacturer’s protocol of NEBuilder® HiFi DNA Assembly kit (New England Biolabs, UK). The resulting plasmid was named pHERDmCh ...
-
bioRxiv - Cancer Biology 2023Quote: ... the tissue samples were stained using Vizgen’s Cell Boundary Kit (Vizgen, 10400009) and blocked in blocking solution (Vizgen, 20300012) supplemented with a 1:20 dilution of Rnase inhibitor (NEB, M0314L) for one hour ...
-
bioRxiv - Biochemistry 2023Quote: ... cDNA synthesis and qRT-PCR were performed in a one-pot reaction using Luna® Universal One-Step RT-qPCR Kit (NEB). A QuantStudio Real-Time PCR System (ThermoFisher ...
-
bioRxiv - Cell Biology 2023Quote: ... a PCR fragment containing the complete Nv-osk coding sequence was synthesized for protein expression with PURExpress® In Vitro Protein Synthesis Kit (New England Biolabs) using manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA-Seq libraries were prepared with NEBNext Poly(A) mRNA Magnetic Isolation Module and NEBNext® UltraTMII Directional RNA Library Prep Kit (New England Biolabs). Libraries were sequenced using the NovaSeq 6000 system (Illumina ...
-
Multi-omics analysis reveals signatures of selection and loci associated with complex traits in pigsbioRxiv - Genomics 2023Quote: ... sequencing libraries were generated using the rRNA-depleted RNA by NEBNext UltraTM Directional RNA Library Prep Kit for Illumina (NEB, USA) following the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2023Quote: ... The remaining RNA was used to produce the sequencing libraries using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs Inc.) with AMPure XP (Beckman Coulter Life Sciences ...
-
bioRxiv - Immunology 2023Quote: ... Ribosomal RNA from 1000 ng total extracted RNA was depleted using a NEBNext rRNA Depletion Kit (Human/Mouse/Rat; New England Biolabs Inc.). The remaining RNA was used to produce the sequencing libraries using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs Inc. ...
-
bioRxiv - Molecular Biology 2023Quote: ... A total of 3 - 10 × 106 EB-derived CD71+ were processed per biological replicate and libraries of sufficient quality were indexed using NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs: E7645) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... adapter ligation and PCR amplification (9 cycles) was performed using NEBNext Ultra II directional RNA library prep kit for Illumina protocol (NEB, E7760) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... oligonucleotides corresponding to each CTCF element were cloned into the pROSA-TV2 vector (created by Prof. Benjamin Davies group) between the pair of BsaI sites using the Golden Gate Assembly Kit (NEB, E1601) and this generates the HDR donor template containing the inserted CTCF element ...
-
bioRxiv - Neuroscience 2023Quote: ... All the libraries were prepared together using the NEBNext® Ultra™ II RNA Library Prep Kit (New England BioLabs Inc.) as per the manufacturer’s protocol within one sitting ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from starter cultures of the three original ancestor isolates and 10 trimethoprim-resistant derivatives using New England Biolabs Monarch Genomic DNA Extraction Kit (New England Biolabs, USA) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and used to generate sequencing libraries using the NEBNext Ultra II FS Library Prep kit (New England Biolabs, Ipswich, MA, USA), followed by sequencing on the Illumina MiSeq platform to generate 250 bp paired end reads ...
-
bioRxiv - Genomics 2023Quote: ... and strand-specific sequencing libraries were made using the NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs, E7760S) with eight cycles of amplification ...
-
bioRxiv - Developmental Biology 2023Quote: Libraries for RNA sequencing were generated using the NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB #E6420) in conjunction with NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs ...
-
bioRxiv - Molecular Biology 2023Quote: ... the same amount of input RNA was loaded for library preparation using the NEBNext Multiplex Small RNA library preparation kit (New England Biolabs, USA). Libraries were size-selected for fragments 15-50 bp by gel electrophoresis ...
-
bioRxiv - Biochemistry 2023Quote: ... XBP1 Part A and Part B were produced by adding a T7 promoter sequence (TAATACGACTCACTATAGGG) and using the HiScribe T7 RNA Synthesis Kit (NEB E2040S). Template DNA was digested by adding DNase I and incubation for 15 min at 37 °C ...
-
bioRxiv - Plant Biology 2024Quote: cDNA libraries with different insert sizes were constructed using the NEB Next Ultra TM Directional RNA Library Prep Kit for Illumina (NEB, USA) following the manufacturer’s recommendations and were assessed on an Agilent Bioanalyzer 2100 system ...
-
bioRxiv - Genomics 2023Quote: ... and strand-specific sequencing libraries were made using the NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs, E7760S) with 8 cycles of amplification ...
-
bioRxiv - Genomics 2023Quote: 50μl of size selected DNA was used as the start material for library generation using NEBNext Ultra II DNA library preparation kit for Illumina (NEB E7645S). The end preparation (end repair and A tailing ...
-
bioRxiv - Microbiology 2023Quote: ... and the appropriate crRNA gBlock (IDTDNA; Coralville, IA) was inserted using the NEBuilder HiFi DNA assembly kit (New England Biolabs (NEB); Cambridge ...
-
bioRxiv - Microbiology 2023Quote: ... Region of Cori and ter were quantitatively amplified using the Sybr green-based Luna Universal One-step RT-qPCR kit (New England Biolabs Inc.), without the reverse transcriptase enzyme ...
-
bioRxiv - Immunology 2022Quote: ... The immunoprecipitated DNAs were subsequently processed to generate a DNA library using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, # E7645L) and NEBNext® Multiplex Oligos for Illumina (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... night RNAseq libraries were produced according to the manufacturer’s protocol (NEBNext UltraII Directional RNA Library Prep Kit, Illumina, NEB, MA, USA) using aroung 1 000 ng of total RNA ...
-
bioRxiv - Microbiology 2022Quote: ... The viral cDNAs were synthesized from extracted RNA using the Luna Script RT Super Mix Kit (New England BioLabs, Ipswich, MA), followed by DNA amplification by multiplex PCR in two separated primer pools using ARTIC-N5 primers (59 ...
-
bioRxiv - Immunology 2022Quote: ... Caspase-11 catalytic (C254A) and cleavage (D285A) mutants were generated by site-directed mutagenesis (Q5 SDM Kit, New England BioLabs; #E0554S) of the wild-type parent vector according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... The library for sequencing was prepared using 1 µg of RNA and the NEBNext Ultra kit (New England BioLabs, Ipswich, MA), according to the protocol for low-input samples ...
-
bioRxiv - Microbiology 2022Quote: ... 1-step RT-qPCR was performed on 2μL of RNA using the Luna® Universal One-Step RT-qPCR Kit (NEB Biosciences) and primers for β-tubulin (F ...
-
An apical protein, Pcr2, is required for persistent movement by the human parasite Toxoplasma gondiibioRxiv - Cell Biology 2022Quote: ... and inserted between the BglII and AflII sites of ptubA1-mEmeraldFP-TUBA1[69] using the NEBuilder HiFi Assembly kit (New England Biolabs, #E2621S).
-
bioRxiv - Molecular Biology 2022Quote: ... Libraries were made with 6 ng of CUT&RUN DNA fragments using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB #E7645S). The manufacturer’s protocol was adjusted to account for shorter DNA fragments as described previously (33) ...
-
bioRxiv - Molecular Biology 2022Quote: ... for each co-expressed DF-APOBEC1 protein using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760L) with NEBNext Poly(A ...
-
bioRxiv - Developmental Biology 2022Quote: ... equal amount of DNA (∼2 ng) was used as an input for NEB Ultra II DNA library prep kits (NEB #E7645). Number of cycles for amplification of adapter ligated libraries were estimated by the qPCR before final amplification to avoid any bias arising due to PCR amplification and indexing (NEB #E7350) ...
-
bioRxiv - Biochemistry 2022Quote: ... and for OGA we introduce a D174>A mutation with a Q5 site-directed mutagenesis kit (New England Biolabs cat # E05545). These mutations produce stable mutant proteins that abolish the catalytic activity of the enzymes (38,39) ...
-
bioRxiv - Cancer Biology 2022Quote: In vitro transcription of LINC00313 or firefly luciferase (F-luc) mRNA was performed using the HiScribe™ T7 High Yield RNA Synthesis kit (New England Biolabs), according to the instructions by the manufacturer ...