Labshake search
Citations for New England Biolabs :
8651 - 8700 of 10000+ citations for Mouse Dachshund Homolog 1 DACH1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... and cDNA was prepared with Protoscript II first-strand cDNA synthesis kit as per manufacturer’s protocol (New England Biolabs, USA). The full-length Spike glycoprotein was subsequently amplified with Prime Star GXL DNA polymerase (Takara Bio ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... a knockout construct was assembled into the suicide plasmid vector pZDJ 78 with either the Gibson Assembly Cloning Kit or the NEBuilder HiFi DNA Assembly Master Mix (both New England Biolabs). The antibiotic resistance cassette flanked by flippase recognition target (FRT ...
-
bioRxiv - Genomics 2022Quote: ... DNA was ultrasonicated to a fragment size of 270 bp and the library was prepared using an Ultra DNA Library Prep Kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: The V7 variant of AR was generated from peGFP-C1-AR using the Q5 site-directed mutagenesis kit and primer design tools (New England BioLabs) with the following primer pair:
-
bioRxiv - Developmental Biology 2022Quote: ... Deletions within the nhr-23 3′ UTR reporter (cloned in pHR017) were created using a Q5 Site-Directed Mutagenesis Kit (NEB) and verified by Sanger Sequencing (Genewiz Inc.) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the eluted DNA was used to make sequencing libraries using the NEBNext Ultra or Ultra II DNA Library Prep Kit for Illumina (NEB) with NEBNext Multiplex dual index primers with 12 amplification cycles and 2 additional AMPure XP clean-up steps at 0.8X ...
-
bioRxiv - Molecular Biology 2022Quote: ... Proteinase K was inactivated (20 min 82 °C) and the crRNA target site was amplified with One Taq Hot Start DNA polymerase kit (NEB), followed by Sanger sequencing (primers in Table S3) ...
-
bioRxiv - Cell Biology 2023Quote: ... Library quality was confirmed using an Agilent BioAnalyzer 2100 and quantified using the NEBNext Library Quant Kit for Illumina (New England Biolabs). Sequencing was performed using the Illumina NextSeq500 platform employing a single-end ...
-
bioRxiv - Microbiology 2023Quote: ... Transcription and fluorescent labelling of RNA in vitro transcription reactions were carried out using a T7 RNA transcription kit (HiScribe T7 High Yield; New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... and p.2.5’ genomic RNA was generated by in vitro transcription using the HiScribe™T7 ARCA mRNA kit (New England Biolabs). For ZIKV-WT ...
-
bioRxiv - Cell Biology 2023Quote: ... and library prep performed on the beads using the NEBNext Ultra II DNA library prep kit for Illumina (NEB, E7645L), according to the manufacturer instructions ...
-
bioRxiv - Microbiology 2022Quote: ... and the extracted RNA was reverse transcribed using LunaScript® RT SuperMix Kit (Cat. NEB #E3010; New England Biolabs, MA). The feline IFNγ mRNA were evaluated using primers (5’AATACCAGCTCCAGTAAACGG 3’ ...
-
bioRxiv - Microbiology 2022Quote: ... and the extracted RNA was reverse transcribed using LunaScript® RT SuperMix Kit (Cat. NEB #E3010; New England Biolabs, MA). The feline IFNγ mRNA were evaluated using primers (5’AATACCAGCTCCAGTAAACGG 3’ ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcription was performed on 500 ng of total RNA using a LunaScript™ RT SuperMix Kit (New England Biolabs) as according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... RT-qPCR for SARS-CoV-2 from cell lysates was performed using the TaqMan assay for the CDC N1 gene primers and probes from Integrated DNA Technologies (catalog no. 10006600; Integrated DNA Technologies) using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) as previously described (6) ...
-
bioRxiv - Microbiology 2023Quote: In vitro transcription reactions were carried out using a T7 RNA transcription kit (HiScribe T7 High Yield; New England Biolabs) with the following modifications ...
-
bioRxiv - Immunology 2022Quote: ... capture and RNA libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs) and sequenced on a NovaSeq 6000 (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... performed to exchange the previous gRNA sequence was achieved using a Q5 mutagenesis kit (New England Biolabs, Ipswich, Massachusetts, USA). gRNA sequences were inserted into pTREX-n-Cas9 using primers specific to the gene of interest in Supplementary Table 4 ...
-
bioRxiv - Microbiology 2023Quote: ... PYD and HD mutants were generated from full length IFI207-HA plasmids and the R1-PYD mutant from R1-IFI207 using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). IFI207-HIN plasmids were generated by PCR amplification of the HIN domain from full length IFI207-V5 expression plasmids ...
-
bioRxiv - Microbiology 2023Quote: ... pDS01 and pDS02 were constructed by restriction digestion with BamHI and SbfI followed by ligation with a Quick Ligation Kit (NEB). All other plasmids were constructed using a HiFi DNA assembly kit (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... RNA samples were then subjected to qRT-PCR of BB0838 and flaB transcripts using the Luna Universal One-Step RT-qPCR kit (NEB) and an ABI Prism 7500 system (Applied Biosystems ...
-
bioRxiv - Microbiology 2023Quote: ... Cloning was performed by assembling the purified PCR fragments into the specified pET derivative expression vector using the commercially available NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs).
-
bioRxiv - Microbiology 2023Quote: ... A stop codon was inserted after amino acid residue 370 by site directed mutagenesis using Q5 Site-Directed Mutagenesis Kit (NEB), in order to express the truncated N1-370 construct ...
-
bioRxiv - Genomics 2023Quote: ... 170-200 ng of library was indexed using NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs). The manufacturer’s protocol was followed with the following deviations ...
-
bioRxiv - Genetics 2023Quote: ... Genomic DNA from single adult male flies was extracted using using the Monarch Genomic DNA Purification Kit (New England Biolabs), using a protocol we developed (dx.doi.org/10.17504/protocols.io.bp2l694qklqe/ v1 ...
-
bioRxiv - Cell Biology 2023Quote: ... 500ng of total RNA were used for RNA-Seq library preparation with the NEBNext Ultra II RNA Library Prep Illumina Kit (NEB) and sequenced with the NextSeq 500/550 sequencing platform (performed at the NYUAD Sequencing Center within the NYUAD Core Technology Platform) ...
-
bioRxiv - Plant Biology 2022Quote: ... Libraries were then generated using 10 ng of DNA and NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 500 ng RNA was used for library preparation using NEBNext Ultra II Directional RNA Library Prep kit (NEW ENGLAND BioLabs) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... the C-terminus of the Apoptin encoding plasmid was removed and replaced with the Mxe-GyraseA Intein using the NEBuilder HiFi DNA Assembly Kit (New England Biolabs). Sanger sequencing of resulting plasmids was carried out by GENEWIZ.
-
bioRxiv - Molecular Biology 2023Quote: RNA-seq libraries were prepared with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). Sequencing libraries were quantified by qPCR ...
-
bioRxiv - Microbiology 2023Quote: ... pLENTI-CMV-GPRC5A was mutated to remove m6A sites (A57G, G120T, C174T, A264G) using Q5 site directed mutagenesis kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The amplicons were inserted into pMQ123 downstream of the Ptac promoter using the NEBuilder HiFi DNA Assembly kit (New England BioLabs) according to the manufacturer specifications ...
-
bioRxiv - Microbiology 2023Quote: Reporter fusions of sRNA targets were in-vitro translated in the absence and presence of sRNA using the PURExpressⓇ In Vitro Protein Synthesis kit (NEB). Four picomoles of in-vitro transcribed 5’UTR reporters (including the RBS/sRNA interaction site and the first 10 codons of flgM ...
-
bioRxiv - Cancer Biology 2022Quote: ... the fragments were purified and used for adapter ligation and library amplification using the NEBNext Ultra II Fs DNA Library kit for Illumina (NEB # E7805, New England BioLabs) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: RNA-Seq Libraries were generated using the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (NEB). The RNA-Seq libraries were quantified by Qubit and qPCR according to the Illumina Sequencing Library qPCR Quantification Guide and the quality of the libraries was evaluated on Agilent Bioanalyzer 2100 using the Agilent DNA-1000 chip ...
-
bioRxiv - Molecular Biology 2023Quote: ... mutants of UFD1-His6 (deletion of amino acids 2-215) and NPL4 (T590L+F591V point mutations) 18 were generated using the Q5 Site-Directed Mutagenesis kit (New England Biolabs).
-
bioRxiv - Cell Biology 2023Quote: PCR amplification was carried out using a Q5® High-Fidelity DNA Polymerase kit (#M0491L, New England Biolabs, Ipswich, MA) using the following protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... four cycles of RD were performed using the PureExpress in vitro protein synthesis kit (New England Biolabs, Ipswich, MA, USA) for in vitro transcription and translation ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA was obtained by reverse transcription of 0.5 μg of total RNA using ProtoScript II First Strand cDNA Synthesis Kit (NEB, #E6560S). Three independent biological replicates were prepared for each genotype ...
-
bioRxiv - Developmental Biology 2023Quote: ... Then the sequencing library was generated by the NEBNext® Ultra II DNA Library Prep Kit (New England Biolabs; E7103S) and NEBNext® Multiplex Oligos for Illumina® (New England Biolabs Index Primers Set 1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Next-generation sequencing libraries were prepared using the NEBNext® Enzymatic Methyl-seq Kit (New England Biolabs, cat. no. E7120). Libraries were sequenced using a NovaSeq 6000 device in paired-end sequencing mode 2x150 cycles.
-
bioRxiv - Immunology 2023Quote: ... Polyadenylated transcript enrichment and strand specific library preparation was completed using a NEBNext Ultra II mRNA kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... Frozen plant tissue was ground to a powder and RNA was extracted using Monarch ® Total RNA Miniprep kits (NEB), RNA integrity and concentration were assessed by agarose gels and a Nanodrop spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Biophysics 2023Quote: ... The plasmid pJH114 was used to create the plasmid pJH114-ΔB encoding BamACDE by deleting the bamB gene using the Q5 Site-directed mutagenesis kit (New England Biolabs). The bamA gene ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was submitted to Genome Quebec for library preparation using the NEBNext Ultra II DNA Library Prep Kit (New England Biolabs) and 150 bp paired-end shotgun sequencing on an Illumina NovaSeq 6000 platform.
-
bioRxiv - Molecular Biology 2023Quote: ChIP–seq Illumina libraries were generated for immunoprecipitated and input samples using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB). Sample concentrations were determined using the DeNovix dsDNA Ultra High Sensitivity Kit ...
-
bioRxiv - Genetics 2023Quote: ... The genomic sequence CATGGTATAAAGTGAATCAAGG was targeted by the plasmid pDSP45 which was made from pDD162 (Dickinson et al., 2013) using the Q5 site-directed mutagenesis kit (NEB).
-
bioRxiv - Cell Biology 2023Quote: ... all strains were generated by the S1/2/3/4 homologous recombination PCR integration method (Janke et al., 2004) using a Q5 PCR Kit (NEB). S1-S2 primers was used to knock out endogenous proteins ...
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA was pre-amplified with pooled barcoded primers before libraries were prepared with NEBNext Ultra DNA Library Prep Kit for Illumina (New England Biolabs) using the AMPure XP reagent (AgenCourt Bioscience ...
-
bioRxiv - Genomics 2023Quote: ... Short read Illumina sequencing libraries were prepared using the NEBNext Ultra DNA library prep kit for Illumina (New England Biolabs), and sequenced on an Illumina HiSeq 2500 ...