Labshake search
Citations for New England Biolabs :
8551 - 8600 of 10000+ citations for Mouse Dachshund Homolog 1 DACH1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... The PCR product was purified by phenol chloroform extraction and RNA was synthesized using the HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB). 1 ug of starting linear DNA template was used and transcription was performed for 2hrs at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... or (Q71L for Arf1) and dominant negative (T27N for Arf6) or (T31N for Arf1) by using site-directed mutagenesis (SDM kit from NEB) kit ...
-
bioRxiv - Cell Biology 2024Quote: ... or 3 * 106 cells with the lowest or highest 5% of Spry4:H2B-Venus fluorescence were FAC sorted and their DNA isolated by column-based genomic DNA purification (Monarch Genomic DNA Purification Kit, NEB). For reference ...
-
bioRxiv - Cancer Biology 2024Quote: ... and a final concentration determination was performed using NEBNext® Library Quant Kit for Illumina (New England Biolabs Cat. E7630) prior to library sequencing.
-
bioRxiv - Cell Biology 2024Quote: ... site-directed mutagenesis of the codon encoding lysine at amino acid position 41 was altered to alanine using the Q5 site-directed mutagenesis kit (New England Biolabs) using pPM11 as a template ...
-
bioRxiv - Cancer Biology 2024Quote: ... Purified ChIP DNA was used to prepare Illumina multiplexed sequencing libraries using the NEBNext Ultra II DNA Library Prep kit and the NEBNext Multiplex Oligos for Illumina (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... The 3xFLAG- and HA-tagged ZNRF3 expression vectors were generated with the Q5 Hot Start High-Fidelity DNA Polymerase Kit (New England Biolabs) by replacing the FLAG-tag ...
-
bioRxiv - Cell Biology 2024Quote: ... Poly(A) RNA libraries were constructed using NEBNext Ultra II RNA Library Prep Kit for Illumina (New England BioLabs, #E7770) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... T7 promoter region was added to the 5’ end of each construct for in vitro transcription of RNA using T7 RNA polymerase from T7 HiScribe RNA synthesis kit (New England Biolabs). Synthesized RNA was subjected to DNase treatment (TURBODNase ...
-
bioRxiv - Molecular Biology 2024Quote: ... and sequenced on a NextSeq 2000 instrument (Srp2-HTP & Dbp2-HTP) or with the NEBNext Fast DNA Library Prep Set for Ion Torrent Kit (NEB) and sequenced on an Ion Torrent Proton (Life Technologies ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and cloned into the BsaI sites of pSGAb-km and pBECAb-apr using a Golden Gate Assembly Kit (New England Biolabs) to generate pSGAb_ataA and pBECAb_ataA ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The resulting amplicons were assembled with SalI- and KpnI-cut pSGAb-ataA using the NEBuilder HiFi DNA assembly kit (New England Biolabs) to generate pSGAb-ataA_HR.
-
bioRxiv - Molecular Biology 2023Quote: ... The RNA samples were subjected to DNase I treatment to avoid genomic DNA contamination using a DNase I kit [New England Biolabs (NEB), USA] following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 72mer Ψ-containing model RNA used for mutation analysis and the 1.8-kb 10% Ψ-modified RNA used for UHPLC-MS/MS were prepared by T7 in vitro transcription using HiScribe T7 High Yield RNA Synthesis Kit (NEB) and Pseudo-UTP (Jena Bioscience ...
-
bioRxiv - Molecular Biology 2024Quote: SINV was produced from pT7-SVwt plasmid90 that was first linearized with XhoI and purified to use it as a template for in vitro RNA transcription with HiScribe T7 ARCA mRNA kit (NEB). Transcribed viral RNA was transfected into BHK-21 using Lipofectamine 3000 reagent (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... from HIV-1 infected cells was digested and ligated with linkers using the NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs) and its associated protocol ...
-
Spatial visualization of A-to-I Editing in cells using Endonuclease V Immunostaining Assay (EndoVIA)bioRxiv - Molecular Biology 2024Quote: ... Cells were lysed and total RNA was isolated and purified using the Monarch Total RNA Miniprep Kit (New England BioLabs). This purified RNA was then used to prepare sequencing libraries with the Tru-Seq Stranded with RiboZero Gold (Human/Mouse/Rat ...
-
bioRxiv - Molecular Biology 2024Quote: ... the UGI in pYPQ265E2 was replaced by 2xUGI using the NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs®) to generate A3A-Y130F-nzCas9-2xUGI ...
-
bioRxiv - Molecular Biology 2024Quote: ... digested by NheI and BamHI were jointed together with 15-20 bp overlapping sequences using the NEBuilder HiFi DNA Assembly Cloning Kit (NEB).
-
bioRxiv - Genomics 2024Quote: ... and the library preparation was conducted using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). Sequencing was performed on the NextSeq500 machine (Illumina) ...
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA was isolated from agar plate-grown seedlings by acid guanidinium thiocyanate-phenol-chloroform-based extraction and purified from the aqueous phase using the Monarch RNA Clean Up Kit (New England Biolabs, Ipswich, MA, USA; NEB). Genomic DNA in the samples was removed using TURBO™ DNase (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2024Quote: ... each genomic segment was amplified as two PCR products and cloned in the pDIVA backbone (Wetzel et al., 2018) using the NEBuilder HiFi DNA Assembly kit (NEB). The CP-RT ORF (without viral UTRs ...
-
bioRxiv - Neuroscience 2024Quote: ... were generated from a pENTR cyfip2-EGFP plasmid [32] using custom primers and the Q5 Site Directed Mutagenesis Kit (NEB) to induce the desired C179R (ΔRac1 ...
-
bioRxiv - Neuroscience 2024Quote: ... Silent mutations were introduced at the PAM site of the HDR vector by using the Q5 site-directed mutagenesis kit (New England Biolabs). The APEX2-V5-Ten-m HDR and the Ten-m gRNA vectors were co-injected into vas-Cas9124 fly embryos by BestGene ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR products were used to constructed libraries using NEB Next Ultra DNA Library Prep Kit for Illumina (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2024Quote: ... Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT) within loxP-N with the lox17:2272 site (ATAACTTCGTATAGGATACTTTATAGCAATTTAT) using a Q5 Site-Directed Mutagenesis kit (New England Biolabs) and PCR ...
-
bioRxiv - Neuroscience 2024Quote: ... Libraries were generated using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (New England Biolabs, #E7645L) according to the manufacturer’s instructions and PCR amplified ...
-
bioRxiv - Immunology 2024Quote: ... Oxford Genomics Centre prepared bulk RNA libraries using an NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina (New England Biolabs) and sequenced the samples at a depth of 25 million reads per sample on a NovaSeq6000 (Illumina) ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA was synthesized from 500ng RNA using a Multiscribe High Capacity cDNA Synthesis kit (Thermo) and qPCR was performed using Luna qPCR Master Mix (New England Biolabs) against primers listed in table 2.
-
bioRxiv - Neuroscience 2024Quote: ... a V5 tag was inserted after the start codon of Ten-m cDNA (isoform B) in the plasmid pUAST-attB-Ten-m5 using the Q5 site-directed mutagenesis kit (New England Biolabs). To generate the UAS-V5-Ten-m-ΔICD and UAS-V5-Ten-m-ΔECD constructs ...
-
bioRxiv - Developmental Biology 2024Quote: ... Stored lenses were kept at either 4°C for up to one week or -20°C for up to one month before purification of total RNA with the Monarch Total RNA Miniprep Kit (NEB). We used approximately 30 lenses at 10 dpf ...
-
bioRxiv - Developmental Biology 2024Quote: ... Poly(A) mRNA library preparation was performed using NEBNext Ultra II DNA library prep kit for illumina (New England BioLabs) and 2x100bp paired-end sequencing was performed at a depth of 50 million reads on an Illumina Novaseq 6000 platform by the University of Toronto Donelly Sequencing Centre ...
-
bioRxiv - Cell Biology 2024Quote: ... the RNA underwent quantification and quality assessment before library preparation using the NEBNext Ultra RNA Library Prep Kit for Illumina (NEB) in accordance with the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNA resistant mCherry-ALG-2 was created by mutagenesis (primers sequences 5’-ATTTCGATGTTTGACCGTGAGAAC-3’, 5’-AATGGACCTGACAGTCACTGGATTAAA-3’) using a Q5 Site-Directed Mutagenesis Kit (E0554S, NEB). The plasmid encoding IST1-GFP is as described (63 ...
-
bioRxiv - Immunology 2024Quote: ... pUC57-mini plasmids harboring the WT or mutated coding sequence downstream of T7 promoter were first transcribed into mRNA using the HiScribe T7 ARCA mRNA Kit (New England BioLabs) according to manufacturer’s protocol ...
-
bioRxiv - Genetics 2024Quote: ... The DNA fragments were blunt-ended and ligated to the Illumina index using the NEBNext Ultra II DNA Library Prep kit for Illumina (New England BioLabs). Libraries for next-generation sequencing were prepared and sequenced with a NovaSeq 6000 instrument (Illumina) ...
-
bioRxiv - Evolutionary Biology 2024Quote: RNA was extracted from heads and thorax+abdomen of one female and one male using the Monarch Total RNA Miniprep Kit (New England, BioLabs). RNA was purified by ethanol precipitation and equal concentration of head and thorax+abdomen tissue was pooled for sequencing ...
-
bioRxiv - Genomics 2024Quote: ... 400 ng genomic DNA of each sample was used to construct whole-genome DNA libraries with an NEBNext Ultra II FS DNA Library prep kit (NEB) and NEBNext Multiplex Oligos for Illumina (NEB) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... We generated a next-generation sequencing library using an NEB Ultra II DNA Library Prep kit (New England Biolabs, MA) with an Illumina-compatible y-adapter ...
-
bioRxiv - Developmental Biology 2023Quote: ... WGA DNA was subsequently processed for Illumina library sequencing preparation using TruSeq indexing of the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs). NEBNext Multiplex Oligos for Illumina (96 index primers ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we multiplexed the different DNA extractions using the NebNext Ultra II FS Library Prep Kit (#E7805, #E6440 and #E6177; NEB). Briefly ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR reaction was then used as a template for in vitro transcription using EnGen® sgRNA Synthesis Kit (NEB), and the MEGACLEAR Transcription Clean-Up KIT (Invitrogen ...
-
bioRxiv - Genomics 2024Quote: ... and reverse-stranded sequencing libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs). Libraries were sequenced on an Illumina NovaSeq 6000 machine ...
-
bioRxiv - Evolutionary Biology 2024Quote: RNA libraries were constructed using the NEBNext Ultra II RNA Library prep for Illumina kit (New England Biolabs, MA, USA), NEBNext Poly(A ...
-
bioRxiv - Genomics 2024Quote: ... Library amplification (10-12 PCR cycles) was carried out using the NEBNext Ultra II DNA Library Prep Kit (New England Biolabs), with IDT for Illumina UD Indexes (96x ...
-
bioRxiv - Developmental Biology 2024Quote: ... followed by the conversion of the remaining RNA into an Illumina sequencing library using the NEBNext Ultra Directional RNA Library Prep kit (New England Biolabs). Following library preparation ...
-
bioRxiv - Developmental Biology 2024Quote: ... mRNA Magnetic Isolation Module (E7490L) and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (E7760L, New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Genetics 2024Quote: ... RNA sequencing libraries were prepared with unique barcodes using the NEBNext Ultra RNA library kit for Illumina (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... mRNA used for comparison in NAGE gels was produced using a HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... The PCR amplicon was purified by sequential gel extraction (1.5% agarose gel prepared in 0.5x TAE) and affinity column chromatography (Monarch® PCR & DNA Cleanup Kit, New England Biolabs). For IVT synthesis ...