Labshake search
Citations for New England Biolabs :
8901 - 8950 of 10000+ citations for Mouse Dachshund Homolog 1 DACH1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... mRNA was eluted from the oligo-dT beads and fragmented by incubating with the First Strand Synthesis Reaction buffer and Random Primer Mix (2×) from the NEBNext Ultra II Directional Library Prep Kit for Illumina (#NEBE7760; New England Biolabs) for 15Lmin at 94°C ...
-
bioRxiv - Immunology 2023Quote: ... Two μg of RNA served as template for cDNA synthesis using oligo dT and murine leukemia reverse transcriptase as implemented in the OneTaq RT PCR kit (New England Biolabs). A panel of oligonucleotides designed to amplify mouse Ig V genes as described by Wang et al (81 ...
-
bioRxiv - Genomics 2023Quote: ... Illumina multiplexing indices were ligated to individual samples using a Phusion polymerase kit (high-fidelity Taq polymerase, New England Biolabs). Final pools were single-end sequenced on four lanes to a length of 75 base pairs (bp ...
-
bioRxiv - Molecular Biology 2023Quote: ... Targets were then transcribed to RNA using the T7 HiScribe High Yield RNA Synthesis Kit in 55 μL reactions (New England Biolabs) with a 16h incubation step at 37 °C and purified with 1.8X volume AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... Micro-C libraries were then prepared using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs) as described74 and sequenced using an Illumina NovaSeq 6000.
-
Regulation of transcription patterns, poly-ADP-ribose, and RNA-DNA hybrids by the ATM protein kinasebioRxiv - Molecular Biology 2023Quote: ... as well as input samples were used to make sequencing libraries using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB) with NEBNext Multiplex dual index primers using 12 amplification cycles and 2 additional AMPure XP clean-up steps at 0.8X ...
-
bioRxiv - Microbiology 2023Quote: ... The fragments containing the transposon-junctions were amplified by PCR and prepared for sequencing using the NEB Ultra I kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... PolyA+ RNA was purified from ∼100 ng of total RNA and sequencing libraries were prepared with the NEBNext Ultra II RNA library kit (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Purified DNA was then made into libraries suitable for Illumina sequencing using the NEXT UltraII library preparation kit (NEB, UK). ChIP libraries were sequenced on the Illumina Hiseq 2500 at the Tufts University Genomics facility.
-
bioRxiv - Molecular Biology 2023Quote: ... Short nucleotide sequences were used for transcription according to the HiScribe Quick T7 High Yield RNA Synthesis Kit (NEB, UK) protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... was used as input for PolyA+ directional RNA-seq library preparation using the NEBNext Ultra II Directional RNA-seq Kit (#E7765, NEB) with the PolyA mRNA magnetic isolation module (#E7490 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Six multiplex amplicons were ligated to Illumina TruSeq adapters using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB), pooled ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sequence ready polyA-enriched libraries were prepared using the NEB Ultra II Directional mRNA prep kit for Illumina (NEB, E7760), according to manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2023Quote: ... mRNA was transcribed from 500 ng purified linearized template using the HiScribe T7 High-Yield RNA Synthesis Kit (New England BioLabs) with co-transcriptional capping by CleanCap AG (TriLink Biotechnologies ...
-
bioRxiv - Biochemistry 2023Quote: ... and linearized by the appropriate Type IIS enzyme (BspQI or BsmBI) and purified by Monarch RNA Cleanup kit (New England Biolabs) prior to IVT reactions.
-
bioRxiv - Biophysics 2023Quote: ... by site-directed mutagenesis of the HT-rad21 and HT-CTCF plasmids using the Q5 Site-Directed Mutagenesis Kit (New England BioLabs) according to the manufacturer’s protocol with primers given in Supplementary Table 18 ...
-
bioRxiv - Bioengineering 2023Quote: ... The IVT reaction product was treated with DNase I to remove the DNA template and then purified using the Monarch RNA clean-up kit (NEB). dgRNA concentration was measured using a NanoDrop.
-
bioRxiv - Cancer Biology 2023Quote: ... NGS libraries were prepared from 30ng of the PCR product using the NEBnext Ultra II DNA library preparation kit for Illumina (New England Biolabs) according to manufacturer’s recommendations and using NEBNext® Multiplex Oligos for Illumina® (96 Unique Dual Index Primer Pairs ...
-
bioRxiv - Cancer Biology 2023Quote: ... the cDNA libraries were prepared from prepared RNA by Novogene using a Next® UltraTM RNA Library Preparation Kit (NEB) and sequenced using a NovaSeq 6000 platform (Illumina) ...
-
bioRxiv - Cancer Biology 2023Quote: The pGEMT-KILR construct was linearized with NotI then in vitro transcribed using the HiScribe T7 Quick High Yield RNA synthesis kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... was used in sequential reverse transcription and PCR amplification steps using the Protoscript II first strand cDNA synthesis kit and Q5 Hi-fidelity DNA polymerase (NEB) according to manufacturer’s protocols ...
-
bioRxiv - Systems Biology 2023Quote: ... RT-qPCR quantification was carried out on 20 ng of RNA with the Luna One-Step RT-qPCR Kit (NEB). All qPCRs were performed in technical triplicates ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA-seq libraries were prepared with NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, E7765) and their quality was assessed on Bioanalyzer using High Sensitivity DNA assay (Agilent) ...
-
bioRxiv - Cell Biology 2023Quote: ... and GPNMB-EGFP-C425S constructs were generated by site-directed mutagenesis using a Q5 Site-Directed Mutagenesis Kit (#E0552S, New England Biolabs). All plasmids were sequenced to verify successful modification ...
-
bioRxiv - Cell Biology 2023Quote: ... Libraries were prepared using the NEBNext Ultra RNA Library Prep Kit for Illumina following manufacturer’s instructions (NEB, Ipswich, MA, USA). The sequencing libraries were validated on the Agilent TapeStation (Agilent Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... Viral RNA quantification was performed by RT-qPCR using the IP4 set of primers and probe and the Luna Universal Probe One-Step RT-qPCR Kit (NEB). Serial dilutions of a titrated viral stock were analyzed simultaneously to express viral loads as eqPFU per gram of tissue.
-
bioRxiv - Bioengineering 2023Quote: ... The IVT reaction product was treated with DNase I to remove DNA template and then purified using the Monarch RNA clean-up kit (NEB). RNA concentration was measured using a NanoDrop (ThermoFisher).
-
bioRxiv - Bioengineering 2023Quote: ... The sequencing library was generated using NEBNext® UltraTM II DNA Library Prep Kit (New England Biolabs, MA, United States) and sequenced on an Illumina Nova6000 platform generating 250-bp paired-end reads (Guangdong Magigene Biotechnology Co. ...
-
bioRxiv - Molecular Biology 2023Quote: ... by replacing the green fluorescent protein (GFP) with a mCherry reporter using the NEBuilding HiFi DNA Assembly Cloning Kit (New England Biolabs) (Ran et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA sequencing libraries were prepared with the NEBNext Ultra II DNA library prep kit according to the manufacturer’s instructions (New England Biolabs, E7645S) and sequenced on the Illumina NextSeq platform with the 75-cycle paired end kit (NextSeq 500/550 High Output Kit).
-
bioRxiv - Systems Biology 2023Quote: ... the sequencing library was generated with the NEBNext® Ultra™II Directional RNA Library Prep Kit (New England Biolabs) and paired-end sequencing was processed with the NovaSeq 6000 (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR amplification of transposon-genome junctions was performed using the cycling parameters described in the kit for 11 cycles with Q5 Ultra II FS Master Mix (NEB) using primers YL006 (AGCGGCAATTTCACACAGGA ...
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA was extracted from 5-10 µl of the cell scrape and prepared for sequencing using the NEBNext Ultra II FS DNA Library Prep Kit (NEB) with the following modifications ...
-
bioRxiv - Plant Biology 2023Quote: The EYFP reporter constructs for nuclear localization were created by bridging the linearized proGL2:EYFP SR54 binary vector lacking the GL2 cDNA with ssDNA oligos using the NEBuilder HiFi DNA Assembly Kit (New England Biolabs) and oligonucleotides given in Supplemental Table S3 ...
-
bioRxiv - Plant Biology 2023Quote: circRNAs were produced by in-vitro transcription from annealed DNA oligonucleotide templates (Table S2) using HighScribe T7 high-yield RNA synthesis kit (NEB) along with ATP ...
-
bioRxiv - Plant Biology 2023Quote: ... followed by first-strand cDNA synthesis with the NEBNext Ultra II RNA Library Prep Kit for Illumina (New England Biolabs) and NEBNext Multiplex Oligo for Illumina (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... brucei BFs CN PIP5Pase exclusively expressing V5-tagged PIP5Pase WT or mutant D360A/N362A for 24 h using the magnetic mRNA isolation kit (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The catalytic residue H528 of esaD was mutated to encode an alanine using a Q5 site-directed mutagenesis kit (NEB). esxCBED amplified from COL genomic DNA was then inserted upstream of esaD by HiFi assembly ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA libraries were prepared using a NEBNext Ultra II Directional RNA Library Prep Kit with rRNA Depletion (New England Biolabs) and sequenced using an Illumina NovaSeq 6000 with 150×150 cycle paired end sequence run ...
-
bioRxiv - Microbiology 2023Quote: ... Approximately 100 ng of total RNA was used in the detection and quantification of TgCPDH transcripts using the Luna Universal One-Step RT-PCR kit (NEB). Data acquisition was collected using the BioRad CFX96 Touch Real-Time PCR detection system ...
-
bioRxiv - Microbiology 2023Quote: ... which was created by substituting the codon encoding cysteine at amino acid residue position 2 on HypC with a codon decoding as alanine using site-directed mutagenesis (Q5 Site-Directed Mutagenesis Kit, New England Biolabs) employing the oligonucleotides HypCfwd (5’-TATACATATGGCGATAGGCGTTCCCGG-3’ ...
-
bioRxiv - Genomics 2023Quote: ... Library preparation was performed using the NEBNext Ultra II Directional RNA Library Prep Kit (New England BioLabs Inc. MA, USA) for strand-specific Illumina libraries ...
-
bioRxiv - Microbiology 2023Quote: ... MARCH2 chimeras containing the TM domains from either human MARCH4 or human transferrin receptor (TR) were generated using the NEBuilder HiFi DNA assembly kit (New England Biolabs) and the primers listed in Supplemental Table S2 ...
-
bioRxiv - Cell Biology 2023Quote: ... FLAG-tagged transgenes of AMOTL2 and HA-tagged MAGI-1 WW domains were obtained from Integrated DNA Technologies as gBlock HiFi Gene Fragments and cloned into the pCMV6 backbone via Gibson assembly using a HiFi DNA Assembly Cloning Kit (NEB).
-
bioRxiv - Cancer Biology 2023Quote: ... and RNA-seq libraries were prepared using a NEB-Next Ultra II Directional Library Prep Kit for Illumina (E7760, NEB). Library sizes were determined on a Bioanalyzer ...
-
bioRxiv - Systems Biology 2023Quote: ... and total RNA libraries were prepared with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs), using 700ng of RNA per sample ...
-
bioRxiv - Biochemistry 2023Quote: ... and cloned into BamHI- and XhoI-digested pcDNA5/FRT vector using the NEBuilder HiFi DNA Assembly kit (New England Biolabs). The resultant construct ...
-
bioRxiv - Developmental Biology 2024Quote: ... Barcoded libraries were made with NEBNext Ultra II DNA Library Prep Kit for Illumina) using NEBNext Multiplex Oligos Dual Index Primers for Illumina (New England BioLabs) and sequenced on NextSeq2K (Illumina ...
-
bioRxiv - Systems Biology 2023Quote: ... Whole metagenome sequencing libraries were prepared from 26 µL of DNA solution using the NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs). The DNA was purified and size selected to remove excess adaptors and adaptor dimers using Ampure XP beads (Beckman Coulter Life Sciences) ...
-
bioRxiv - Plant Biology 2023Quote: ... EM-seq libraries were prepared from sheared DNA using an enzymatic methyl-seq kit following the standard instructions (New England BioLabs), and were subjected to NextSeq550 using 75bp paired-end sequencing ...