Labshake search
Citations for New England Biolabs :
8701 - 8750 of 10000+ citations for Mouse Dachshund Homolog 1 DACH1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... pDS01 and pDS02 were constructed by restriction digestion with BamHI and SbfI followed by ligation with a Quick Ligation Kit (NEB). All other plasmids were constructed using a HiFi DNA assembly kit (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... RNA samples were then subjected to qRT-PCR of BB0838 and flaB transcripts using the Luna Universal One-Step RT-qPCR kit (NEB) and an ABI Prism 7500 system (Applied Biosystems ...
-
bioRxiv - Genetics 2023Quote: ... whole genome bisulfite sequencing single indexed libraries were generated using NEBNext Ultra DNA library Prep kit for Illumina (New England BioLabs) according to the manufacturer’s instructions with modifications ...
-
bioRxiv - Molecular Biology 2023Quote: ... then adapter ligation was carried out using the sequencing adapters supplied with the kit and NEB Blunt/TA Ligase Master Mix (New England Biolabs).
-
bioRxiv - Molecular Biology 2023Quote: All RPL39 variants were cloned into the pRS413-GPD plasmid digested by the BamHI and SalI using the Gibson assembly kit (NEB). Guide blocks (IdT ...
-
bioRxiv - Genomics 2023Quote: Sequencing libraries were prepared with the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (NEB, #E7765L) in 96-well plates ...
-
bioRxiv - Molecular Biology 2023Quote: ... The library was resolved on a 1% agarose gel and the smear between 300-600 bp was extracted using Monarch DNA Gel Extraction Kit (New England Biolabs).
-
bioRxiv - Genomics 2023Quote: ... we used the NEB Next PPFE repair kit with Ultra II end prep reaction (New England Biolabs, Ipswich, MA, USA) under recommended conditions and Nanopore ligation sequencing kit SQK-LSK110 ...
-
bioRxiv - Genomics 2023Quote: ... RNA-seq poly-A libraries were generated with NEBNext UltraII directional RNA library prep kit for Illumina (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was submitted to Genome Quebec for library preparation using the NEBNext Ultra II DNA Library Prep Kit (New England Biolabs) and 150 bp paired-end shotgun sequencing on an Illumina NovaSeq 6000 platform.
-
bioRxiv - Plant Biology 2023Quote: ... The fragments were then transferred into pGGA000 in a Golden Gate assembly reaction using the NEBridge Golden Gate Assembly Kit (BsaI-HF v2) (New England Biolabs). To clone the transcriptional reporter lines ...
-
bioRxiv - Developmental Biology 2023Quote: ... The corresponding bands were cut out and pooled all in one tube followed by purification using the Monarch DNA Gel extraction Kit (T1020; NEB) and subsequently repurified using the DNA cleanup kit (T1030 ...
-
bioRxiv - Molecular Biology 2023Quote: ChIP–seq Illumina libraries were generated for immunoprecipitated and input samples using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB). Sample concentrations were determined using the DeNovix dsDNA Ultra High Sensitivity Kit ...
-
bioRxiv - Immunology 2023Quote: ... Reverse transcription was performed on RNA samples using the ProtoScript II first strand cDNA synthesis kit (New England BioLabs; E6560S) with HRV serotype-specific reverse primers (Rev 5’- -3’) ...
-
bioRxiv - Genomics 2023Quote: ... were used to remove rRNA from total RNA and libraries prepared using the NEBNext Ultra II Directional RNA Library Prep Kit (NEB, New England Biolabs). The libraries were sequenced on an Illumina NovaSeq S4 (Illumina ...
-
bioRxiv - Biophysics 2023Quote: ... The plasmid pJH114 was used to create the plasmid pJH114-ΔB encoding BamACDE by deleting the bamB gene using the Q5 Site-directed mutagenesis kit (New England Biolabs). The bamA gene ...
-
bioRxiv - Microbiology 2023Quote: Verification of modification of the pv6 locus was performed by first isolating genomic DNA from transfected parasites (Monarch genomic DNA isolation kit, New England Biolabs). Integration of targeting plasmid at the pfs47 locus was determined with primer pairs CVO119-CVO120 (wildtype locus and integrated locus) ...
-
bioRxiv - Immunology 2023Quote: ... The RNA sequencing libraries were generated using NEB Next Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB) according to manufacturer’s protocol and sequenced on a NovaSeq 6000 sequencer (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... The RNA fusion targets were transcribed from plasmids using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, Ipswich, MA), isolated using the Monarch Kit (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... total RNA samples from lungs at 4 dpi were subjected to library preparation using NEBNext Ultra II Directional RNA Library prep kit for Illumina (New England Biolabs) and sequenced on an Illumina NovaSeq 6000 with 150 base pair-end reads at Azenta ...
-
bioRxiv - Cancer Biology 2023Quote: ... Quality control and quantification of the resulting dual-indexed barcoded libraries was performed with Agilent TapeStation and by qPCR (NEBNext Library Quant Kit for Illumina, New England Biolabs).
-
bioRxiv - Neuroscience 2023Quote: ... RNAseq libraries were generated by the Cornell TREx Facility using the NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs) using 700ng input total RNA per sample ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... PCR-based mutagenesis was carried out using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs®, MA, USA) as per the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA (5ng) was used for sequencing library construction using NEBNext Ultra II DNA Library Prep Kit for Illumina (Cat # E7645, NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... in combination with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina and NEBNext Multiplex Oligos for Illumina (Unique Dual Index Primer Pairs) (New England BioLabs). The resulting libraries were subjected to sequencing on a NextSeq 550 Sequencing System (Illumina ...
-
bioRxiv - Genetics 2023Quote: ... The genomic sequence CATGGTATAAAGTGAATCAAGG was targeted by the plasmid pDSP45 which was made from pDD162 (Dickinson et al., 2013) using the Q5 site-directed mutagenesis kit (NEB).
-
bioRxiv - Microbiology 2023Quote: ... and cloned into the vector pCE along with a 30 bp site specific spacer sequence (in the gene to be deleted) using Gibson assembly (Gibson Assembly Cloning Kit, New England Biolabs) using 1µg of fragments and plasmid at a 3:1 ratio then incubating at 50 °C for 4 hours ...
-
bioRxiv - Plant Biology 2023Quote: ... To allow BiFC imaging of pSITE and pROK based sYFP tags the pSITE YFPc sequences were extended and pSITE YFPn sequences shortened accordingly using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) and the primers listed in Table S1.
-
bioRxiv - Plant Biology 2023Quote: ... A cDNA clone for the 2b protein of Ho-CMV was recapitulated by site-directed mutagenesis of the coding sequence of the Fny-CMV 2b protein using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). The resultant DNA product encoding the recapitulated Ho-CMV 2b protein contained the amino acid substitutions S47A ...
-
bioRxiv - Systems Biology 2023Quote: ... the library pool ranging from 135 to 146 bp including the DNA marker were gel purified and quantified by NEBNext Library Quant kit (NEB) using QuantStudio 5 Real-Time PCR System (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2023Quote: G4tr (UUAGGG)4 and G4mt (UUACCG)4 were prepared using an in vitro the HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs) following the manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Each fraction containing protein-bound RNA was purified and prepared for RNA-sequencing library using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). All the libraries were sequenced on a NextSeq 500 sequencer (Illumina) ...
-
bioRxiv - Systems Biology 2023Quote: ... Total RNA library preparation was done by introducing 500 ng total RNA into Illumina’s NEBNext Ultra II directional mRNA (UMI) kit (NEB, E7760S), following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA samples were DNAse treated with the Turbo DNAse (Thermo-Fisher) followed by cleanup with the Monarch RNA Cleanup Kit (NEB). Reagents were used according to the manufacturer’s recommendations.
-
bioRxiv - Microbiology 2023Quote: ... Point mutations were introduced in the N sequence by site-directed mutagenesis using the Q5 site-directed mutagenesis Kit (New England Biolabs). Sequence analysis was carried out to check the integrity of all constructs ...
-
bioRxiv - Biochemistry 2023Quote: ... A TEV protease cut site preceding the 6x histidine tag was previously introduced using the Q5 Site-Directed Mutagenesis Kit from NEB and the GeneJET Plasmid Miniprep Kit from ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... Library quality was assessed using an Agilent Tapestation 4200 instrument and quantity determined by qPCR using an NEBnext library quantification kit (NEB). Libraries were sequenced as described previously46 and reads are available from ArrayExpress using accession code E-MTAB-11906 ...
-
bioRxiv - Neuroscience 2023Quote: The EEF1A2 CDS was cloned into pcDNA3.1-FLAG (gift from Saunders Lab) using NEBuilder® HiFi DNA Assembly Cloning Kit (NEB) according to the protocol of the manufacturer ...
-
bioRxiv - Developmental Biology 2023Quote: ... Mutagenesis of csn-5(D152N) was performed using a Q5 site-directed mutagenesis kit per manufacturer instructions (New England BioLabs). For transgenic lines used in PLA ...
-
bioRxiv - Physiology 2023Quote: ... Single and double mutations targeting the candidate residues identified by computational modeling were generated by the Q5 Site-directed mutagenesis kit (New England BioLabs). More complex compound mutations were generated in synthetic gene fragments (TWIST Bioscience) ...
-
bioRxiv - Biochemistry 2023Quote: ... was prepared by in vitro transcription using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs Inc., Massachusetts, USA) with 1 unit RNase Inhibitor (New England Biolabs Inc. ...
-
bioRxiv - Cancer Biology 2023Quote: Libraries were prepared by the Van Andel Institute Genomics Core from an input of 41 ng to 51 ng of ChIP DNA (taken directly from DNA IP’d for siQ-ChIP-seq) using the NEBNext Enzymatic Methyl- seq Kit (New England Biolabs E7120L). The denaturation method used was 0.1 N sodium hydroxide ...
-
bioRxiv - Cell Biology 2023Quote: ... we generated CRISPR/Cas9 vectors by mutating the UPRT guide RNA sequence in the plasmid pSag1-Cas9-U6-sgUPRT [33] to a guide RNA sequence of the target gene by using Q5 Site-Directed Mutagenesis Kit (NEB). The CRISPR/Cas9 plasmid and the PCR amplicon were transfected into corresponding parental parasites by using the Lonza Nucleofector and Manufacture suggested protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... Site-specific mutagenesis of double-stranded plasmid DNAs were constructed using the Q5 Site-Directed Mutagenesis Kit (E0554S, New England Biolabs), according to the manufacturer’s instructions.
-
bioRxiv - Evolutionary Biology 2023Quote: ... coding exons of Gdf1/3 were individually amplified from genomic DNA templates and then assembled into the pXT7 vector using a Gibson cloning kit (New England Biolabs). Nodal ...
-
bioRxiv - Developmental Biology 2023Quote: ... MYC) were made in-house by in vitro transcription using mRNA synthesis with HiScribeTM T7 ARCA mRNA Kit (NEB E2060S) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... and ligated to hairpin adaptor 2 (ENDseq-adaptor-2, 5′-Phos-GATCGGAAGAGCACACGTCUUUUUUUUAGACGTGTGCTCTTCCGATC*T-3′ [*phosphorothioate bond]) (Quick ligation kit, NEB). To prepare libraries for sequencing ...
-
bioRxiv - Biochemistry 2023Quote: Library preparation was performed with 5 µL of twice poly(A)-enriched sample using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England BioLabs) according to manufacturer’s instructions for “Protocol for use with Purified mRNA or rRNA Depleted RNA” ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The eluted DNA fragments were then amplified by PCR with Nextera compatible indexed sequencing i5 and i7 adapters using NEBNext 2x PCR Master Mix PCR kit (M0541, NEB). The amplified DNA library was fragment size selected from 200bp to 800bp using Ampure XP beads (A63880 ...
-
bioRxiv - Genetics 2023Quote: ... RT-qPCR was performed on 10 ng total RNA using the Luna Universal One-Step RT-qPCR Kit (NEB, E3005L). bin3 ...