Labshake search
Citations for New England Biolabs :
8401 - 8450 of 10000+ citations for Mouse Dachshund Homolog 1 DACH1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: RNA-seq libraries were prepared using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, NEB) and NEBNext rRNA Depletion Kit (Human/Mouse/Rat ...
-
bioRxiv - Developmental Biology 2022Quote: RNA-seq libraries were prepared using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, NEB) and NEBNext rRNA Depletion Kit (Human/Mouse/Rat ...
-
bioRxiv - Cell Biology 2022Quote: ... 400 ng of high integrity total RNA (RIN >5) was depleted of rRNA using the NEBNext rRNA Depletion Kit (New England BioLabs). NEXTflex Rapid Directional RNA-Seq Kit (Bio-Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 μl of the oligo reaction was ligated with 50 ng of digested pX330 vector and was assessed using the Quick Ligase kit (New England Biolabs) for 20 min at room temperature according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: Paired end libraries were constructed using the NEBNext Ultra II RNA Library Prep Kit (New England Biolabs, Ipswich, MA, USA) following the manufacturer’s protocol and sequenced on a NovaSeq 6000 (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... another membrane-localized FRB (stargazin-iRFP670-FRB) was also generated by inserting FRB into Lego-iV2-stargazin-iRFP670 via the Q5 site-directed mutagenesis kit (NEB). The FRET-based VE-cad-TS (Addgene Plasmid# 45848 ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA fragments were amplified by PCR and transcribed to sgRNAs in vitro with HiScribe Quick T7 High Yield RNA Synthesis Kit (New England Biolabs), and sgRNAs were purified with Monarch RNA Cleanup Kit (New England Biolabs) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Library preparation was performed using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB #E7645S), following the manufacturer’s instructions.
-
bioRxiv - Genomics 2022Quote: ... Tip60 and Lam were generated by PCR amplifying the coding sequence of each chromatin factor from an embryonic cDNA library 54 with Gibson Assembly adaptor sequences and ligating using an NEB Hifi assembly kit (NEB). Cloning primers were designed using Perlprimer 55 ...
-
bioRxiv - Immunology 2022Quote: ... The constructs expressing mutant SLFNs (SLFN11 E209A, SLFN11 E214A, SLFN12 E200A and SLFN12 E205A) were generated using Q5 Site-Directed Mutagenesis Kit (NEB). The mutagenesis was performed according to the substitution protocol using primers designed with the NEBaseChanger (NEB) ...
-
bioRxiv - Immunology 2022Quote: Protein expression plasmids were constructed using dsDNA gBlocks from IDT and NEBuilder® HiFi DNA Assembly Cloning Kit (NEB, E5520S) and then transformed in NEB 5-alpha competent cells (NEB ...
-
bioRxiv - Genetics 2022Quote: The detection of aberrant Scyl1 transcripts was performed by RT-PCR using primers designed to amplify sequences between exon 2 to exon 5 (RT-Scyl1_F21 5’-CGCAGTGTCCATCTTCGTGTA-3’ and RT-Scyl1_R51 5’-CCCGGCAGTTCTGCAGGAA-3’) following the OneTaq One-Step RT-PCR Kit (New England Biolabs, E5315S) procedure ...
-
bioRxiv - Genetics 2022Quote: ... I23A was introduced at the same time with GFP knock-in by incorporating the corresponding mutation in the 3’ homology arm on the repair template plasmid using the Q5 site-directed mutagenesis kit (New England Biolabs). GermLine Optimized mScarlet-i sequence (Fielmich et al ...
-
bioRxiv - Genetics 2022Quote: ... samples with the best fragmentation and high concentration were used for the creation of NGS libraries (NEBNEXT ULTRA II DNA Library Prep kit, NEB) and sequencing (Illumina Next seq 500 ...
-
bioRxiv - Genetics 2022Quote: ... we also isolated genomic DNA from post-mortem liver tissue using the Monarch® Genomic DNA Purification Kit (NEB, T3010S).
-
bioRxiv - Immunology 2022Quote: RNA from sorted Kmt2d-knockout and littermate control thymic cells was isolated by centrifugation to pellet and resuspended in 300 μL of Protection Buffer (Monarch RNA Isolation Kit, #T2010S; New England Biolabs Inc. (NEB), Ipswich ...
-
bioRxiv - Immunology 2022Quote: ... followed by a NEBNext Ultra II Directional RNA library prep kit for Illumina (#E7760 and/or #E7770 with #E7765; NEB) with size selection by AMPure XP (#Ab3881 ...
-
bioRxiv - Immunology 2022Quote: Fab fragments were generated by inserting a stop codon six amino acids upstream of the hinge region (CPPCP) of the heavy chain expression plasmid using the Q5 Site-Directed Mutagenesis Kit (New England BioLabs). This mutagenized plasmid was co-transfected with the respective light chain plasmid ...
-
bioRxiv - Immunology 2022Quote: ... A subset of SIV Envs was further modified by site-directed mutagenesis (Q5 Site-Directed Mutagenesis Kit; New England BioLabs) to incorporate amino acid changes previously reported to improve the germline-targeting capacity of HIV-1 Envs (20 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... we extracted genomic DNA from a hind leg of each adult using Monarch Genomic DNA Purification Kit (New England Biolabs) and amplified the DNA using a UVRh1-specific primer pair (5’ CAAGCATTTGTCATTGATGCA 3’ ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... genomic DNA was extracted from the dissected thorax of single adult male and female butterflies from each species using Monarch Genomic DNA Purification Kit (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2022Quote: ... and cloned upstream of the TRP2 terminator and NatMX6 drug marker cassette in a pUC19-based vector using the NEB HiFi Assembly kit (New England Biolabs). This AB614_yOTC plasmid (GenBank ...
-
bioRxiv - Plant Biology 2022Quote: ... the plasmid was purified and used as template in a single reaction for dsRNA synthesis using the HiScribe T7 High Yield RNA synthesis kit (NEB). For plasmidic DNA removal ...
-
bioRxiv - Plant Biology 2022Quote: ... the acquired Mlathy INR and INR-like sequences were confirmed by PCR using the Q5 Hot Start High-Fidelity kit (NEB), enzymatic clean-up using ExoSAP-IT™ (Thermo Fisher scientific ...
-
bioRxiv - Microbiology 2022Quote: crRNAs were synthesized for in vitro cleavage experiments using the HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs; NEB). Templates for in vitro transcription were generated by hybridizing a ssDNA oligo with the T7 promoter to another oligo with the complementary T7 promoter sequence fused to the LbCas12a repeat and spacer in annealing buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... Libraries were barcoded, quantified using the NEBNext Ultra RNA Library Prep Kit for Illumina (Cat No. 7530, New England Biolabs (NEB)) ...
-
bioRxiv - Physiology 2022Quote: ... and Poly-A mRNA-seq libraries from such samples were prepared using the Ultra II Directional RNA Library kit (New England BioLabs) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: A total of 1 ng of purified ChIP-ed DNA for each sample was used for library preparation using Ultra II DNA kit (NEB) as per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Anti-sense RNA probes were then generated by in vitro transcription using Sp6 polymerase and purified with the Monarch RNA Cleanup Kit (NEB). Primers and gene block sequences are provided in Supplementary Table 1 and 2 ...
-
bioRxiv - Microbiology 2022Quote: ... and 100 ng of the enriched mRNA used to generate cDNA libraries with unique barcodes (Next UltraII Directional RNA Library Prep kit for Illumina, New England Biolabs). The cDNA libraries were pooled and subjected to RNA-Seq analysis at the UF-ICBR using the Illumina NextSeq 500 platform ...
-
bioRxiv - Molecular Biology 2022Quote: ... Other G2L4 and GII RT mutant plasmids were derived from pMal-G2L4 RT or pMal-GII RT by using a Q5 mutagenesis kit (New England Biolabs).
-
bioRxiv - Molecular Biology 2022Quote: ... and the gel regions that contain thyA genes with deletions were extracted by using a Monarch DNA gel extract kit (New England Biolabs). 1 ng of extracted PCR products were analyzed by an Agilent High Sensitivity DNA kit on an Agilent 2100 Bioanalyzer (Agilent) ...
-
bioRxiv - Molecular Biology 2022Quote: ... with a 47-bp DNA region with flanking SpeI and XbaI sites by using a Q5 mutagenesis kit (New England Biolabs). MBP-RT-8XHis ORFs were inserted into pCas9SX by PCR amplifying the pBL1-MBP-RT-8XHis ORFs with primers that introduce flanking SpeI and XbaI sites and cloning the PCR product between the corresponding sites of pCas9SX.
-
bioRxiv - Microbiology 2022Quote: ... from the original pSAG1-Cas9-GFP-UPRT (Shen et al., 2014)) for one targeting the LFM1 locus using the Q5 site-directed mutagenesis kit (NEB). 1 µg of the cassette and 1 µg of Cas9 plasmid were transfected into the LMF1-HA cell line using the Lonza nucleofection system ...
-
bioRxiv - Microbiology 2022Quote: ... Indexed libraries were prepared from the resulting RNA using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs). Samples were pooled and sequenced on a NextSeq 500 sequencer (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... These vectors were generated by mutating the sgRNA site in the pSag1-Cas9-U6-sgUPRT-HXG plasmid [14] using the Q5 Site-Directed Mutagenesis Kit (NEB). The two guide RNAs were designed to target TgEFP1 at either of the predicted EF-hand domains using the online E-CRISP tool (http://www.e-crisp.org/E-CRISP/) ...
-
bioRxiv - Microbiology 2022Quote: ... The rRNA-depleted samples were used for stranded library preparation using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). The libraries were sequenced on a HiSeq2500 (Illumina ...
-
bioRxiv - Microbiology 2022Quote: In order to generate the MksG mutants (MksGE236A, MksGD279A, MksGY258A, MksGY276A) site-directed mutagenesis (Q5 site-directed mutagenesis Kit, NEB) was performed ...
-
bioRxiv - Microbiology 2022Quote: ... we executed mutagenic PCR oligonucleotide primers KT1604 and KT1606 and the Q5® Site-Directed Mutagenesis Kit (New England Biolabs) according to manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Mutants were sequenced using Illumina Miseq and libraries were prepared using the DNA Ultra II library preparation kit (New England Biolabs). Mutations and depth were mapped using CLC-Bio Workbench v8 78.
-
bioRxiv - Microbiology 2022Quote: ... The fragment library was prepared using the NebNext Ultra II DNA Library preparation kit (New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... and cDNA libraries containing unique barcodes generated from 100 ng mRNA using the Next UltraII Directional RNA Library Prep kit for Illumina (New England Biolabs). The individual cDNA libraries were assessed for quality and quantity by Qubit ...
-
bioRxiv - Immunology 2022Quote: RNA was extracted from IgG1 stimulated B cells 72 hour post-stimulation using TRIzol reagent (Fisher) and cDNA was prepared using the Protoscript II kit (NEB). Germline transcription was analyzed using quantitative PCR with SYBR Green (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... To perform the qRT PCR we followed the recommendations of the manufacturer Luna Universal One-Step qRT-PCR Kit (New England BioLabs Inc. ...
-
Promoter-adjacent DNA hypermethylation can downmodulate gene expression: TBX15 in the muscle lineagebioRxiv - Molecular Biology 2022Quote: Reporter gene constructs were prepared by overlap extension PCR (Table S5) or by using the Gibson assembly kit (NEBuilder HiFi Assembly, New England Biolabs) as previously described [28] ...
-
bioRxiv - Molecular Biology 2022Quote: ... The other molecular cloning trials and plasmid gene replacements were performed by Gibson’s assembly with Gibson Assembly® Cloning Kit (NEB). The procedure used to generate each plasmid construct is described in the corresponding subsection of Material and Methods.
-
bioRxiv - Molecular Biology 2022Quote: ... Two reactions of 2-4 µg DNA each were adaptor-ligated and indexed using NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs) and NEBNext Multiplex Oligos for Illumina (New England Biolabs) ...
-
bioRxiv - Microbiology 2022Quote: ... Second-strand cDNA was synthesized in a reaction mixture containing Second-Strand Synthesis Kit (New England Biolabs; Ipswich, MA, USA). cDNA was purified using the Qiagen purification kit ...
-
bioRxiv - Microbiology 2022Quote: ... The linear recombineering product was PCR amplified from the resulting plasmid using Phusion High-Fidelity Polymerase and primers MRS09 + MRS10 and PCR purified using the Monarch PCR & DNA Cleanup Kit (T1030, NEB). M ...
-
bioRxiv - Microbiology 2022Quote: ... The first primer pair includes a multiple cloning site and both fragments were assembled using NEBuilder Hifi Assembly Cloning kit (New England Biolabs) together with the promoter and 5’ UTR of the constitutive expressed flavodoxin C4N14_09865 amplified from genomic DNA of F ...